about us   database   info   order clones   imprint   privacy statement   contact
 

 

GGTC German Gene Trap Consortium

 

  home | info | protocols | vectors | ROSAbeta-Geo

 

 

 

 ROSAbeta-Geo+1 - Description

 

Overview-Vectors   |   Description   |   Map   |   Sequence

 

 

 

 

ROSAbeta-Geo

 

 

ROSAßgeo: (reverse oriented splice acceptor ß-galactosidase) This gene-trap vector is the classical retroviral vector developed in the lab of Phil Soriano. It was used in the GGTC for the generation of ES cell clones since July 2000. There exist two versions that differ in the presence of a pointmutation within the ß-Geo sequence. This mutation which is present here leads to a reduced sensitivity against G418. Vectors that do not contain the pointmutation are labeled with a *. Primer used for RACE-PCR are designated as LacZ primers.

For this vector the GGTC uses frameshift variations. Therefore, additional ucleotides were introduced into the adenoviral splice acceptor:

 

 

ROSA beta-Geo 0
 
CAGCTCGCGGTGAGGACAAAC
ROSA beta-Geo +1
original Frame
CAGCTCGCGGTTGAGGACAAAC
ROSA beta-Geo +2
 
CAGCTCGCGGTTTGAGGACAAAC



top