Genotyping gene-trap mutant mice by real-time PCR

Thomas Floss tfloss@helmholtz-muenchen.de, Nikolas Uez, Stefan Frey and Wolfgang Wurst


Thomas Floss, Nikolas Uez, Stefan Frey and Wolfgang Wurst are at the Helmholtz Zentrum München – German Research Center for Environmental Health, Institute of Mammalian Genetics, Ingolstädter Landstr. 1, 85764 Neuherberg, Germany.
 Article Outline  

Materials and methods
Taqman primers and probes
Multiplex PCR primers
Results
Discussion
Acknowledgements
References
Glossary





A major task in the second phase of the genome sequencing projects is the identification of coding sequence within the three billion base pairs of each the mouse and human genomes. At present, in addition to computer-aided programs, several high-throughput mutagenesis programs are being undertaken worldwide in order to achieve this goal (Ref. 1).

Gene-trap mutagenesis screens take advantage of random insertions into transcription units to drive a selection–reporter cassette and simultaneously to mutate the tagged genes. One of the advantages of gene-trap mutagenesis is that no a priori knowledge is needed about the structure of the tagged gene. However, because most gene-trap vectors contain splice-acceptor or splice-donor sites to capture translated gene sequence, the precise location of vector integration within introns is not known. Therefore, it is often difficult to generate external probes for Southern blots or external primers for PCR analysis in order to distinguish between homozygous and heterozygous mutants. To overcome this serious limitation in high-throughput mutagenesis screens, we developed a real-time PCR strategy that allows us to discriminate between mutants with either one or two copies of the gene-trap vector inside their genomes.

Real-time quantitative PCR is based on the quantification of a fluorescent dye [5′-6-carboxyfluorescein (5′-FAM)] that is quenched by 3′-6-carboxy-tetramethylrhodamine (3′ TAMRA) when attached to a probe located between two PCR primers but is activated by the 5′ exonuclease activity of the Taq DNA polymerase (Ref. 2,3 ). Here, we describe a rapid method based on the quantification of a gene-trap vector relative to a standard locus within the mouse genome. This method allows the rapid genotyping of any gene-trap animal without prior knowledge of the mutated genes. Here, as an example, we describe the genotyping of a PT1βgeo insertion (Ref. 4) into the mouse Neurochondrin gene (Ref. 5) by comparing a multiplex PCR assay and a novel real-time-PCR-based method.

 Materials and methods  

Taqman primers and probes

In order to quantify the inserted βgeo vector, primers and probes were designed that amplified a 83 bp fragment within the boundary of the Escherichia coli β-galactosidase gene (lacZ) and the stuffer sequence between lacZ and a neomycin resistance cassette ( Fig. 1).
Fig. 1.
The lacZ amplicon is 83 bp in size. Six base pairs of the 3′ PT1R primer overlap with the stuffer sequence between lacZ and the neomycin-resistance gene (neo).


As a standard amplicon, we chose the murine Burkitt's lymphoma receptor gene 1 (BLR1; NM_007551). The human BLR1 gene (NM_001716) is a two-exon gene that has been previously described as a single-copy standard for human genomic real-time PCR assays (http://www.appliedbiosystems.com/products/pdar.cfm).

Oligonucleotides and probes ( Table 1) were designed using Primer Express (version 4.0; Applied Biosystems). Oligonucleotides and probes were synthesized by Interactiva (now Thermohybaid; http://www.thermohybaid.com/). Optimal oligonucleotide concentrations were determined using a primer matrix (not shown) to be 50 nM, and 250 nM for each TaqMan probe.

Table 1. Real-time PCR primers and probes
Primer     Sequence     Location    
PT1F     ctcctggagcccgtcagtatc     lacZ    
PT1R     atcccctgacaccagaccaa     Stuffer–lacZ    
PT1 probe     FAM–ATTCCAGCTGAGCGCCGGTCG–TAMRA     lacZ    
BLRF     CGGAGCTCAACCGAGACCT     BLR1    
BLRR     tgcaaaaggcaggatgaaga      BLR1    
BLR probe     FAM–CTGTTCCACCTCGCAGTAGCCGAC–TAMRA     BLR1    


15 μl TaqMan Universal PCR Master Mix (Applied Biosystems) were mixed with 50 nM primer and 250 nM probe. Template DNA was prepared from mouse tails using the Qiagen genomic DNA kit according to manufacturer's instructions and dissolved in 200 μl TE buffer. In TaqMan assays, both 300 pg μl−1 and 1 ng μl−1 template DNA worked equally well.

The conditions for the TaqMan PCR reactions were 2 min at 50°C, 10 min at 94°C and 40 repetitions of 20 sec at 94°C, 20 sec at 55°C and 30 sec at 72°C.

The expected bands were 83 bp for PT1βgeo and 77 bp for BLR1. All expected fragments were obtained as single bands, as verified by agarose gel electrophoresis.

Real-time PCR reactions were performed on an ABI Prism 7700 (Applied Biosystems).

Multiplex PCR primers

PCR conditions were as follows.

Hot Start Premix
  • 4 μl 10× PCR buffer with NH4SO4

  • 1 μl DMSO

  • 1 μl of each 10 μM primer ( Table 2)

  • 33 μl H2O

  • 1 μl DNA template (1:100)

Taq–dNTP mix
  • 1 μl 25 mM dNTP mix

  • 1 μl 10× PCR buffer with NH4SO4

  • 7.8 μl H2O

  • 0.2 μl 5 U ml−1 Taq (Fermentas)

PCR parameters
  1. 95°C for 5 min

  2. Hold at 82°C and add Taq–dNTP mix

  3. 94°C for 30 sec, 55°C for 30 sec and 72°C for 2 min, repeated 30 times

  4. 72°C for 7 min

Expected sizes were 1722 bp for the primers int6f and int7r944 (wild type), and 1566 bp for the primers int6f and lac2 (mutant).

Table 2. Multiplex PCR primers and probes
Primer     Sequence     Location    
int6f     TCACTCCGACCTCTTACC     Neurochondrin    
int7r944     AAGCAAGGGGTCAGGCTTAT     Neurochondrin    
lac2     caaggcgattaagttgggtaacg     lacZ    


 Results  

For the Neurochondrin mutation, we analysed 50 F2 generation animals using a multiplex PCR assay with one primer located inside lacZ and two external Neurochondrin primers ( Fig. 2). As a preliminary result, both heterozygous and homozygous animals 3 weeks after birth were determined to lack any obvious defects (T. Floss et al., unpublished).
Fig. 2.
Comparison of real-time PCR genotyping and multiplex PCR genotyping, using identical DNA templates from the gene-trap mouse strain W044B06 (Neurochondrin). (a) Real-time PCR. The BLR1 standard is shown in green and the PT1 vector in red. (b) Multiplex PCR genotyping assay. Abbreviations: M, Marker; 1, heterozygote; 2 and 3, homozygotes.


When reanalysing 39 DNAs that had been previously genotyped by multiplex PCR using the real-time PCR assay ( Table 3), we obtained average threshold cycle (CT) value differences between the BLR standard and the PT1 vector of 1.1 for heterozygotes and 0.08 for homozygotes (the CT value of a given reaction reflects the cycle in which the fluorescence is above the baseline with statistical significance). If two organisms have contents of the amplified fragment that differ by a factor of two, they would be expected to have CT values that differ by 1. Therefore, the real-time PCR assay reliably distinguishes the different quantities within genomic DNA.

Table 3. Threshold cycle (CT) value differences between the BLR standard and the PT1 vector
Genotype     Average CT difference     Expected CT difference    
+/−     1.1     1    
−/−     0.08     0    
−/−     No signal for PT1     n/a    


By Southern blotting using a lacZ-specific probe and DNA digests with two enzymes that either do not cut or cut once inside the vector, the Neurochondrin mutant was found to carry a single PT1 vector integration (not shown).

 Discussion  

We show that the relative quantification of genomic sequence by real-time PCR is a straightforward method for distinguishing between heterozygous and homozygous gene-trap animals (Ref. 6). CT differences of 1 can be distinguished reproducibly and reliably, so we can determine whether a given animal has one or two copies of PT1βgeo in its genome.

The primers and probes described are suitable for the quantification of βgeo-type vectors, which are based on the pT1 gene-trap vector (Ref. 4). Multiple integrations were not genotyped reliably. Single-copy integrations are ideal for genotyping using this technique, and they can best be introduced using retroviruses. In order to determine whether a given mutant can be genotyped by real-time PCR, DNA from F1 animals should be included in the analysis. This method is now facilitating high-throughput mutagenesis using the gene trap or similar insertional mutagenesis methods.

This peer-reviewed article can be cited as: Floss, T., Uez, N., Frey, S. and Wurst, W. (2002) Genotyping gene-trap mutant mice by real-time PCR. Technical Tips Online (http://research.bmn.com/tto) t02593.

 Acknowledgements  

We are grateful to K. Specht, T. Rygus and H-J. Bach for valuable discussion and technical advice. The technical assistance and animal husbandry of L. Ait-Hammou and I. Rodionova is greatly appreciated. This work was funded by the Bundesministerium fuer Bildung und Forschung (BMBF).

 References  

[1] Stanford W.L. et al. (2001) Mouse genomic technologies gene-trap mutagenesis: past, present and beyond.
Nat. Rev. Genet., 10:756-768.

[2] Higuchi R. et al. (1992) Kinetic PCR analysis: real-time monitoring of DNA amplification reactions.
Biotechnology, 4:413-417. Cited by

[3] Higuchi R. et al. (1993) Simultaneous amplification and detection of specific DNA sequences.
Biotechnology, 9:1026-1030. Cited by

[4] Wiles M.V. et al. (2000) Establishment of a gene-trap sequence tag library to generate mutant mice from embryonic stem cells.
Nat. Genet., 1:13-14. Cited by

[5] Ishiduka et al. (1999)
Biochim. Biophys. Acta, 1450:92-98. ScienceDirect MEDLINE Cited by

[6] Hnatyszyn H.J. et al. (2001) The use of real-time PCR and fluorogenic probes for rapid and accurate genotyping of newborn mice.
Mol. Cell Probes, 3:169-175. Cited by

 Glossary