W008G09 - 00123
Sequences producing significant alignments: Score E
(bits) Value
NM  |NM_033327.2|46359076| Mus musculus zinc finger protein 423 (Z  609   e-173
EST |CF540245.1|34592768| UI-M-EX0-bxd-m-09-0-UI.r1 NIH_BMAP_EX0 M  609   e-172
EST |CF531529.1|34583497| UI-M-FY0-cgq-e-23-0-UI.r1 NIH_BMAP_FY0 M  609   e-172
EST |CF162828.1|33272377| B0717C04-5 NIA Mouse Embryonic Germ Cell  609   e-172
EST |CF162640.1|33272189| B0714F04-5 NIA Mouse Embryonic Germ Cell  609   e-172
EST |CB246987.1|28368631| UI-M-FI0-cdy-m-06-0-UI.r1 NIH_BMAP_FI0 M  609   e-172
NR  |BC079586.1|51258979|Mus musculus zinc finger protein 423, mRN  609   e-171
NR  |AY256893.1|37955659|Mus musculus early B-cell factor-associat  609   e-171
NR  |AK122365.1|28972386|Mus musculus mRNA for mKIAA0760 protein.   609   e-171
EST |CJ062420.1|76143543| CJ062420 RIKEN full-length enriched mous  595   e-168
EST |CJ055928.1|76052965| CJ055928 RIKEN full-length enriched mous  551   e-155
EST |BQ180174.1|20355666| UI-M-EX0-bxa-f-08-0-UI.r1 NIH_BMAP_EX0 M  535   e-150
NM  |XM_001000788.1|94384210| PREDICTED: Mus musculus zinc finger   523   e-148
EST |CB519031.1|29352386| UI-M-GH0-cee-n-08-0-UI.r1 NIH_BMAP_GH0 M  523   e-146
EST |BY133219.1|26244320| BY133219 RIKEN full-length enriched, 17.  521   e-146
EST |BY133081.1|26244182| BY133081 RIKEN full-length enriched, 17.  521   e-146
EST |BU056523.1|22496600| UI-M-FO0-cab-n-02-0-UI.r1 NIH_BMAP_FO0 M  519   e-145
NR  |BC059234.1|37589229|Mus musculus zinc finger protein 423, mRN  519   e-144
EST |CB522106.1|29355461| UI-M-GH0-ceo-f-18-0-UI.r1 NIH_BMAP_GH0 M  517   e-144
EST |CN666446.1|47432897| A0840E02-5 NIA Mouse E13.5 whole embryo   511   e-143
EST |BY139756.1|26275307| BY139756 RIKEN full-length enriched, 17.  507   e-141
NM  |NM_015069.2|46359074| Homo sapiens zinc finger protein 423 (Z  438   e-122
NR  |BC112317.1|85567334|Homo sapiens zinc finger protein 423, mRN  438   e-120
NR  |BC112315.1|85567728|Homo sapiens zinc finger protein 423, mRN  438   e-120
NT  |NT_078575.5|94383902|Mus musculus chromosome 8 genomic contig  404   e-110
NR  |AC121809.3|22539326|Mus musculus BAC clone RP23-451B23 from c  404   e-110
NM  |XM_001000781.1|94384212| PREDICTED: Mus musculus zinc finger   398   e-110
NR  |AY147407.1|24061771|Mus musculus early B-cell factor-associat  398   e-108
NR  |AC027348.8|28933552|Homo sapiens chromosome 16 clone CTD-2595  349   3e-93
NR  |AC007339.8|29294010|Homo sapiens chromosome 16 clone RP11-305  349   3e-93
EST |CD351129.1|31142704| UI-M-FY0-cft-h-23-0-UI.r1 NIH_BMAP_FY0 M  319   5e-85
EST |CB246631.1|28368275| UI-M-FI0-cdx-i-15-0-UI.r1 NIH_BMAP_FI0 M  198   1e-48
EST |BU703449.1|23629272| UI-M-FO0-bzo-o-09-0-UI.r1 NIH_BMAP_FO0 M  182   7e-44
NR  |AF221712.1|6760444|Homo sapiens Smad- and Olf-interacting zin  172   3e-40
NR  |AB018303.2|20521643|Homo sapiens mRNA for KIAA0760 protein, p  172   3e-40
EST |BF012461.1|10712736| ux56f04.y1 Soares_NKWMD_mandible Mus mus  141   3e-31
NR  |AC127285.4|51854735|Mus musculus BAC clone RP23-336P20 from c  125   7e-26
EST |CF539414.1|34591793| UI-M-GH0-chr-l-19-0-UI.r1 NIH_BMAP_GH0 M  115   1e-23
EST |CN703198.1|47471947| E0472G09-5 NIA Mouse E11.5 whole embryo   111   2e-22
EST |CN698290.1|47467039| E0405G04-5 NIA Mouse E11.5 whole embryo   111   2e-22
NR  |AC007603.5|29366931|Homo sapiens chromosome 16 clone RP11-305   86   6e-14
EST |CF532954.1|34584922| UI-M-FY0-cgr-d-19-0-UI.r1 NIH_BMAP_FY0 M   80   8e-13






















[ summary ]

>|NM_033327.2|46359076| Mus musculus zinc finger protein 423
           (Zfp423), transcript variant 1, mRNA
          Length = 4916

 Score =  609 bits (307), Expect = e-173
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 351 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 410

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 470

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 530

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 531 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 590

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 650

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 651 ctgtcctgga 660
























[ summary ]

>|CF540245.1|34592768| UI-M-EX0-bxd-m-09-0-UI.r1 NIH_BMAP_EX0 Mus
           musculus cDNA clone IMAGE:5706800 5', mRNA sequence
          Length = 632

 Score =  609 bits (307), Expect = e-172
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 37  agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 96

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 97  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 156

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 157 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 216

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 217 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 276

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 277 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 336

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 337 ctgtcctgga 346
























[ summary ]

>|CF531529.1|34583497| UI-M-FY0-cgq-e-23-0-UI.r1 NIH_BMAP_FY0 Mus
           musculus cDNA clone IMAGE:30356182 5', mRNA sequence
          Length = 735

 Score =  609 bits (307), Expect = e-172
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 394 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 453

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 513

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 514 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 573

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 574 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 633

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 634 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 693

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 694 ctgtcctgga 703
























[ summary ]

>|CF162828.1|33272377| B0717C04-5 NIA Mouse Embryonic Germ Cell cDNA
           Library (Long) Mus musculus cDNA clone NIA:B0717C04
           IMAGE:30459483 5', mRNA sequence
          Length = 455

 Score =  609 bits (307), Expect = e-172
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 17  agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 76

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 77  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 136

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 196

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 256

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 257 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 316

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 317 ctgtcctgga 326
























[ summary ]

>|CF162640.1|33272189| B0714F04-5 NIA Mouse Embryonic Germ Cell cDNA
           Library (Long) Mus musculus cDNA clone NIA:B0714F04
           IMAGE:30459231 5', mRNA sequence
          Length = 446

 Score =  609 bits (307), Expect = e-172
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 17  agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 76

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 77  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 136

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 196

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 256

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 257 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 316

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 317 ctgtcctgga 326
























[ summary ]

>|CB246987.1|28368631| UI-M-FI0-cdy-m-06-0-UI.r1 NIH_BMAP_FI0 Mus
           musculus cDNA clone IMAGE:6836239 5', mRNA sequence
          Length = 764

 Score =  609 bits (307), Expect = e-172
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 79  agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 138

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 139 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 198

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 199 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 258

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 259 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 318

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 378

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 379 ctgtcctgga 388
























[ summary ]

>|BC079586.1|51258979|Mus musculus zinc finger protein 423, mRNA
           (cDNA clone IMAGE:5706800).
          Length = 4609

 Score =  609 bits (307), Expect = e-171
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 37  agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 96

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 97  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 156

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 157 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 216

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 217 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 276

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 277 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 336

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 337 ctgtcctgga 346
























[ summary ]

>|AY256893.1|37955659|Mus musculus early B-cell factor-associated
           zinc finger protein (Ebfaz) mRNA, complete cds,
           alternatively spliced.
          Length = 4805

 Score =  609 bits (307), Expect = e-171
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 250 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 309

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 369

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 429

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 430 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 489

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 490 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 549

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 550 ctgtcctgga 559
























[ summary ]

>|AK122365.1|28972386|Mus musculus mRNA for mKIAA0760 protein.
          Length = 4773

 Score =  609 bits (307), Expect = e-171
 Identities = 309/310 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 317 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 376

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 436

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 437 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 496

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 497 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 556

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 557 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccaccg 616

                     
Query: 328 ctgtcctgga 337
           ||||||||||
Sbjct: 617 ctgtcctgga 626
























[ summary ]

>|CJ062420.1|76143543| CJ062420 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J cerebellum 0 day neonate Mus
           musculus cDNA clone C230031A20 5', mRNA sequence
          Length = 670

 Score =  595 bits (300), Expect = e-168
 Identities = 309/311 (99%), Gaps = 1/311 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 347 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 406

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 466

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 467 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 526

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 527 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 586

                                                                       
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccacc-gggcccacc 326
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 587 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccggggcccacc 646

                      
Query: 327 gctgtcctgga 337
           |||||||||||
Sbjct: 647 gctgtcctgga 657
























[ summary ]

>|CJ055928.1|76052965| CJ055928 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J cerebellum 16 days neonate Mus
           musculus cDNA clone 9630025J09 5', mRNA sequence
          Length = 655

 Score =  551 bits (278), Expect = e-155
 Identities = 292/296 (98%), Gaps = 1/296 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 356 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 415

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 475

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 476 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 535

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Sbjct: 536 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtncatttacacctg 595

                                                                   
Query: 268 cgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggccc 323
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 596 cgatcactgtcagcaggacttcgagtctctggcaga-ctgacggaccaccgggccc 650
























[ summary ]

>|BQ180174.1|20355666| UI-M-EX0-bxa-f-08-0-UI.r1 NIH_BMAP_EX0 Mus
           musculus cDNA clone IMAGE:5705479 5', mRNA sequence
          Length = 675

 Score =  535 bits (270), Expect = e-150
 Identities = 272/273 (99%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 403 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaagttgaagaggg 462

                                                                       
Query: 88  ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 463 ggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctgga 522

                                                                       
Query: 148 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 aggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaacagcgtgac 582

                                                                       
Query: 208 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 583 aagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatttacacctg 642

                                            
Query: 268 cgatcactgtcagcaggacttcgagtctctggc 300
           |||||||||||||||||||||||||||||||||
Sbjct: 643 cgatcactgtcagcaggacttcgagtctctggc 675
























[ summary ]

>|CB519031.1|29352386| UI-M-GH0-cee-n-08-0-UI.r1 NIH_BMAP_GH0 Mus
           musculus cDNA clone IMAGE:6838569 5', mRNA sequence
          Length = 746

 Score =  523 bits (264), Expect = e-146
 Identities = 264/264 (100%)
 Strand = Plus / Plus

                                                                       
Query: 74  aaagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagca 133
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 60  aaagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagca 119

                                                                       
Query: 134 gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 193
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120 gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 179

                                                                       
Query: 194 aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 180 aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 239

                                                                       
Query: 254 tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 299

                                   
Query: 314 caccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||
Sbjct: 300 caccgggcccaccgctgtcctgga 323
























[ summary ]

>|BY133219.1|26244320| BY133219 RIKEN full-length enriched, 17.5
           days embryo whole body Mus musculus cDNA clone
           L930027D15 5', mRNA sequence
          Length = 363

 Score =  521 bits (263), Expect = e-146
 Identities = 263/263 (100%)
 Strand = Plus / Plus

                                                                       
Query: 75  aagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcag 134
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43  aagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcag 102

                                                                       
Query: 135 caggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagaca 194
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 103 caggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagaca 162

                                                                       
Query: 195 ggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagt 254
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 163 ggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagt 222

                                                                       
Query: 255 caatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacc 314
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 223 caatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacc 282

                                  
Query: 315 accgggcccaccgctgtcctgga 337
           |||||||||||||||||||||||
Sbjct: 283 accgggcccaccgctgtcctgga 305
























[ summary ]

>|BY133081.1|26244182| BY133081 RIKEN full-length enriched, 17.5
           days embryo whole body Mus musculus cDNA clone
           L930025N09 5', mRNA sequence
          Length = 387

 Score =  521 bits (263), Expect = e-146
 Identities = 263/263 (100%)
 Strand = Plus / Plus

                                                                       
Query: 75  aagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcag 134
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43  aagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcag 102

                                                                       
Query: 135 caggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagaca 194
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 103 caggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagaca 162

                                                                       
Query: 195 ggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagt 254
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 163 ggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagt 222

                                                                       
Query: 255 caatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacc 314
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 223 caatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacc 282

                                  
Query: 315 accgggcccaccgctgtcctgga 337
           |||||||||||||||||||||||
Sbjct: 283 accgggcccaccgctgtcctgga 305
























[ summary ]

>|BU056523.1|22496600| UI-M-FO0-cab-n-02-0-UI.r1 NIH_BMAP_FO0 Mus
           musculus cDNA clone IMAGE:6409153 5', mRNA sequence
          Length = 718

 Score =  519 bits (262), Expect = e-145
 Identities = 262/262 (100%)
 Strand = Plus / Plus

                                                                       
Query: 76  agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 135
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 210 agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 269

                                                                       
Query: 136 aggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacag 195
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 270 aggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacag 329

                                                                       
Query: 196 gaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtc 255
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 gaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtc 389

                                                                       
Query: 256 aatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacca 315
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 390 aatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacca 449

                                 
Query: 316 ccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||
Sbjct: 450 ccgggcccaccgctgtcctgga 471



 Score =  416 bits (210), Expect = e-114
 Identities = 210/210 (100%)
 Strand = Plus / Plus

                                                                       
Query: 128 gcagcagcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctg 187
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcagcagcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctg 60

                                                                       
Query: 188 gaagacaggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaa 247
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  gaagacaggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaa 120

                                                                       
Query: 248 gatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctg 307
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctg 180

                                         
Query: 308 acggaccaccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||||||||
Sbjct: 181 acggaccaccgggcccaccgctgtcctgga 210
























[ summary ]

>|BC059234.1|37589229|Mus musculus zinc finger protein 423, mRNA
           (cDNA clone IMAGE:6409153), partial cds.
          Length = 4748

 Score =  519 bits (262), Expect = e-144
 Identities = 262/262 (100%)
 Strand = Plus / Plus

                                                                       
Query: 76  agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 135
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 210 agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 269

                                                                       
Query: 136 aggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacag 195
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 270 aggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacag 329

                                                                       
Query: 196 gaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtc 255
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 gaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtc 389

                                                                       
Query: 256 aatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacca 315
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 390 aatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggacca 449

                                 
Query: 316 ccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||
Sbjct: 450 ccgggcccaccgctgtcctgga 471



 Score =  416 bits (210), Expect = e-113
 Identities = 210/210 (100%)
 Strand = Plus / Plus

                                                                       
Query: 128 gcagcagcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctg 187
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcagcagcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctg 60

                                                                       
Query: 188 gaagacaggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaa 247
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  gaagacaggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaa 120

                                                                       
Query: 248 gatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctg 307
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctg 180

                                         
Query: 308 acggaccaccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||||||||
Sbjct: 181 acggaccaccgggcccaccgctgtcctgga 210
























[ summary ]

>|CB522106.1|29355461| UI-M-GH0-ceo-f-18-0-UI.r1 NIH_BMAP_GH0 Mus
           musculus cDNA clone IMAGE:6842227 5', mRNA sequence
          Length = 696

 Score =  517 bits (261), Expect = e-144
 Identities = 261/261 (100%)
 Strand = Plus / Plus

                                                                       
Query: 77  gttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagca 136
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 337 gttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagca 396

                                                                       
Query: 137 ggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacagg 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 397 ggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacagg 456

                                                                       
Query: 197 aacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtca 256
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 457 aacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtca 516

                                                                       
Query: 257 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 517 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 576

                                
Query: 317 cgggcccaccgctgtcctgga 337
           |||||||||||||||||||||
Sbjct: 577 cgggcccaccgctgtcctgga 597
























[ summary ]

>|CN666446.1|47432897| A0840E02-5 NIA Mouse E13.5 whole embryo cDNA
           library (Long) Mus musculus cDNA clone NIA:A0840E02
           IMAGE:30761041 5', mRNA sequence
          Length = 553

 Score =  511 bits (258), Expect = e-143
 Identities = 258/258 (100%)
 Strand = Plus / Plus

                                                                       
Query: 80  gaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcagga 139
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagcagga 60

                                                                       
Query: 140 ggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaac 199
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacaggaac 120

                                                                       
Query: 200 agcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatt 259
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 agcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtcaatt 180

                                                                       
Query: 260 tacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgg 319
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgg 240

                             
Query: 320 gcccaccgctgtcctgga 337
           ||||||||||||||||||
Sbjct: 241 gcccaccgctgtcctgga 258
























[ summary ]

>|BY139756.1|26275307| BY139756 RIKEN full-length enriched, 17.5
           days embryo whole body Mus musculus cDNA clone
           L930125C21 5', mRNA sequence
          Length = 331

 Score =  507 bits (256), Expect = e-141
 Identities = 263/264 (99%), Gaps = 1/264 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  aagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcag 134
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44  aagttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcag 103

                                                                       
Query: 135 caggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagaca 194
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104 caggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagaca 163

                                                                       
Query: 195 ggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagt 254
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 164 ggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagt 223

                                                                       
Query: 255 caatttacacctgcgatcactgtcagcaggacttcgag-tctctggcagacctgacggac 313
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 224 caatttacacctgcgatcactgtcagcaggacttcgagctctctggcagacctgacggac 283

                                   
Query: 314 caccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||
Sbjct: 284 caccgggcccaccgctgtcctgga 307
























[ summary ]

>|NM_015069.2|46359074| Homo sapiens zinc finger protein 423
           (ZNF423), mRNA
          Length = 4846

 Score =  438 bits (221), Expect = e-122
 Identities = 251/261 (96%)
 Strand = Plus / Plus

                                                                       
Query: 77  gttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagca 136
           |||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||
Sbjct: 314 gttgaagagggggaggcctcagacttctcgctggcctgggattcctccgtgacagcagca 373

                                                                       
Query: 137 ggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacagg 196
           |||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 374 ggaggcctagaaggagagccagagtgcgatcagaaaaccagccgtgcgctggaagacagg 433

                                                                       
Query: 197 aacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtca 256
           ||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||| |||
Sbjct: 434 aacagcgtgacaagtcaagaggagagaaatgaggatgatgaagacatggaggatgaatca 493

                                                                       
Query: 257 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 553

                                
Query: 317 cgggcccaccgctgtcctgga 337
           |||||||||||||||||||||
Sbjct: 554 cgggcccaccgctgtcctgga 574
























[ summary ]

>|BC112317.1|85567334|Homo sapiens zinc finger protein 423, mRNA
           (cDNA clone MGC:138522 IMAGE:8327785), complete cds.
          Length = 3980

 Score =  438 bits (221), Expect = e-120
 Identities = 251/261 (96%)
 Strand = Plus / Plus

                                                                       
Query: 77  gttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagca 136
           |||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||
Sbjct: 71  gttgaagagggggaggcctcagacttctcgctggcctgggattcctccgtgacagcagca 130

                                                                       
Query: 137 ggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacagg 196
           |||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 131 ggaggcctagaaggagagccagagtgcgatcagaaaaccagccgtgcgctggaagacagg 190

                                                                       
Query: 197 aacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtca 256
           ||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||| |||
Sbjct: 191 aacagcgtgacaagtcaagaggagagaaatgaggatgatgaagacatggaggatgaatca 250

                                                                       
Query: 257 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 310

                                
Query: 317 cgggcccaccgctgtcctgga 337
           |||||||||||||||||||||
Sbjct: 311 cgggcccaccgctgtcctgga 331
























[ summary ]

>|BC112315.1|85567728|Homo sapiens zinc finger protein 423, mRNA
           (cDNA clone MGC:138520 IMAGE:8327783), complete cds.
          Length = 3980

 Score =  438 bits (221), Expect = e-120
 Identities = 251/261 (96%)
 Strand = Plus / Plus

                                                                       
Query: 77  gttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagca 136
           |||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||
Sbjct: 71  gttgaagagggggaggcctcagacttctcgctggcctgggattcctccgtgacagcagca 130

                                                                       
Query: 137 ggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacagg 196
           |||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 131 ggaggcctagaaggagagccagagtgcgatcagaaaaccagccgtgcgctggaagacagg 190

                                                                       
Query: 197 aacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtca 256
           ||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||| |||
Sbjct: 191 aacagcgtgacaagtcaagaggagagaaatgaggatgatgaagacatggaggatgaatca 250

                                                                       
Query: 257 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 310

                                
Query: 317 cgggcccaccgctgtcctgga 337
           |||||||||||||||||||||
Sbjct: 311 cgggcccaccgctgtcctgga 331
























[ summary ]

>|NT_078575.5|94383902|Mus musculus chromosome 8 genomic contig, strain
                C57BL/6J
          Length = 56546279

 Score =  404 bits (204), Expect = e-110
 Identities = 204/204 (100%)
 Strand = Plus / Minus

                                                                            
Query: 134      gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 193
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15210774 gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 15210715

                                                                            
Query: 194      aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 253
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15210714 aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 15210655

                                                                            
Query: 254      tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 313
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15210654 tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 15210595

                                        
Query: 314      caccgggcccaccgctgtcctgga 337
                ||||||||||||||||||||||||
Sbjct: 15210594 caccgggcccaccgctgtcctgga 15210571



 Score =  125 bits (63), Expect = 2e-26
 Identities = 63/63 (100%)
 Strand = Plus / Minus

                                                                            
Query: 76       agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 135
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15255836 agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 15255777

                   
Query: 136      agg 138
                |||
Sbjct: 15255776 agg 15255774



 Score = 93.7 bits (47), Expect = 6e-17
 Identities = 49/50 (98%)
 Strand = Plus / Minus

                                                                  
Query: 28       agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaag 77
                ||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 15310531 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaag 15310482
























[ summary ]

>|AC121809.3|22539326|Mus musculus BAC clone RP23-451B23 from chromosome
             8, complete sequence.
          Length = 192626

 Score =  404 bits (204), Expect = e-110
 Identities = 204/204 (100%)
 Strand = Plus / Plus

                                                                         
Query: 134   gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 193
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 89972 gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 90031

                                                                         
Query: 194   aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 253
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 90032 aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 90091

                                                                         
Query: 254   tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 313
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 90092 tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 90151

                                     
Query: 314   caccgggcccaccgctgtcctgga 337
             ||||||||||||||||||||||||
Sbjct: 90152 caccgggcccaccgctgtcctgga 90175



 Score =  125 bits (63), Expect = 7e-26
 Identities = 63/63 (100%)
 Strand = Plus / Plus

                                                                         
Query: 76    agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 135
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44910 agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 44969

                
Query: 136   agg 138
             |||
Sbjct: 44970 agg 44972
























[ summary ]

>|AY147407.1|24061771|Mus musculus early B-cell factor-associated
           zinc finger protein (Ebfaz) mRNA, complete cds.
          Length = 4511

 Score =  398 bits (201), Expect = e-108
 Identities = 201/201 (100%)
 Strand = Plus / Plus

                                                                       
Query: 137 ggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacagg 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65  ggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagacagg 124

                                                                       
Query: 197 aacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtca 256
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125 aacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgagtca 184

                                                                       
Query: 257 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 316
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 185 atttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccac 244

                                
Query: 317 cgggcccaccgctgtcctgga 337
           |||||||||||||||||||||
Sbjct: 245 cgggcccaccgctgtcctgga 265
























[ summary ]

>|AC027348.8|28933552|Homo sapiens chromosome 16 clone CTD-2595P9,
              complete sequence.
          Length = 147454

 Score =  349 bits (176), Expect = 3e-93
 Identities = 197/204 (96%)
 Strand = Plus / Plus

                                                                          
Query: 134    gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 193
              ||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||
Sbjct: 118585 gcaggaggcctagaaggagagccagagtgcgatcagaaaaccagccgtgcgctggaagac 118644

                                                                          
Query: 194    aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 253
              |||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||| 
Sbjct: 118645 aggaacagcgtgacaagtcaagaggagagaaatgaggatgatgaagacatggaggatgaa 118704

                                                                          
Query: 254    tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 313
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118705 tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 118764

                                      
Query: 314    caccgggcccaccgctgtcctgga 337
              ||||||||||||||||||||||||
Sbjct: 118765 caccgggcccaccgctgtcctgga 118788



 Score =  101 bits (51), Expect = 1e-18
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                         
Query: 76    agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 135
             ||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||
Sbjct: 60012 agttgaagagggggaggcctcagacttctcgctggcctgggattcctccgtgacagcagc 60071

                
Query: 136   agg 138
             |||
Sbjct: 60072 agg 60074
























[ summary ]

>|AC007339.8|29294010|Homo sapiens chromosome 16 clone RP11-305A7,
             complete sequence.
          Length = 183646

 Score =  349 bits (176), Expect = 3e-93
 Identities = 197/204 (96%)
 Strand = Plus / Plus

                                                                         
Query: 134   gcaggaggcctggaaggagagccagagtgtgatcggaaaaccagccgtgcgctggaagac 193
             ||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||
Sbjct: 71754 gcaggaggcctagaaggagagccagagtgcgatcagaaaaccagccgtgcgctggaagac 71813

                                                                         
Query: 194   aggaacagcgtgacaagtcaagaggagagaaatgaggacgatgaagacgtggaagatgag 253
             |||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||| 
Sbjct: 71814 aggaacagcgtgacaagtcaagaggagagaaatgaggatgatgaagacatggaggatgaa 71873

                                                                         
Query: 254   tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 313
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 71874 tcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcagacctgacggac 71933

                                     
Query: 314   caccgggcccaccgctgtcctgga 337
             ||||||||||||||||||||||||
Sbjct: 71934 caccgggcccaccgctgtcctgga 71957



 Score =  101 bits (51), Expect = 1e-18
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                         
Query: 76    agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 135
             ||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||
Sbjct: 13164 agttgaagagggggaggcctcagacttctcgctggcctgggattcctccgtgacagcagc 13223

                
Query: 136   agg 138
             |||
Sbjct: 13224 agg 13226
























[ summary ]

>|CD351129.1|31142704| UI-M-FY0-cft-h-23-0-UI.r1 NIH_BMAP_FY0 Mus
           musculus cDNA clone IMAGE:6852264 5', mRNA sequence
          Length = 753

 Score =  319 bits (161), Expect = 5e-85
 Identities = 161/161 (100%)
 Strand = Plus / Plus

                                                                       
Query: 177 gccgtgcgctggaagacaggaacagcgtgacaagtcaagaggagagaaatgaggacgatg 236
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gccgtgcgctggaagacaggaacagcgtgacaagtcaagaggagagaaatgaggacgatg 60

                                                                       
Query: 237 aagacgtggaagatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctc 296
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  aagacgtggaagatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctc 120

                                                    
Query: 297 tggcagacctgacggaccaccgggcccaccgctgtcctgga 337
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 tggcagacctgacggaccaccgggcccaccgctgtcctgga 161
























[ summary ]

>|CB246631.1|28368275| UI-M-FI0-cdx-i-15-0-UI.r1 NIH_BMAP_FI0 Mus
           musculus cDNA clone IMAGE:6835768 5', mRNA sequence
          Length = 756

 Score =  198 bits (100), Expect = 1e-48
 Identities = 100/100 (100%)
 Strand = Plus / Plus

                                                                       
Query: 238 agacgtggaagatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctct 297
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   agacgtggaagatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctct 60

                                                   
Query: 298 ggcagacctgacggaccaccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ggcagacctgacggaccaccgggcccaccgctgtcctgga 100
























[ summary ]

>|BU703449.1|23629272| UI-M-FO0-bzo-o-09-0-UI.r1 NIH_BMAP_FO0 Mus
           musculus cDNA clone IMAGE:6405344 5', mRNA sequence
          Length = 502

 Score =  182 bits (92), Expect = 7e-44
 Identities = 113/119 (94%), Gaps = 1/119 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
           |||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||
Sbjct: 383 agccccggacatgtccaggcggtagcaggcgaagccgcgatcggtgaaagttgaataggg 442

                                                                      
Query: 88  gg-aggcctcggacttctcgctggcctgggattcctctgtggcagcagcaggaggcctg 145
           || ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 443 gggaggtctcggacttctcgctggcctgtgattcctctgtggcagcagcaggaggcctg 501
























[ summary ]

>|AF221712.1|6760444|Homo sapiens Smad- and Olf-interacting zinc
           finger protein mRNA, partial cds.
          Length = 3672

 Score =  172 bits (87), Expect = 3e-40
 Identities = 93/95 (97%)
 Strand = Plus / Plus

                                                                       
Query: 243 tggaagatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcag 302
           |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   tggaggatgaatcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcag 61

                                              
Query: 303 acctgacggaccaccgggcccaccgctgtcctgga 337
           |||||||||||||||||||||||||||||||||||
Sbjct: 62  acctgacggaccaccgggcccaccgctgtcctgga 96
























[ summary ]

>|AB018303.2|20521643|Homo sapiens mRNA for KIAA0760 protein,
           partial cds.
          Length = 4248

 Score =  172 bits (87), Expect = 3e-40
 Identities = 93/95 (97%)
 Strand = Plus / Plus

                                                                       
Query: 243 tggaagatgagtcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcag 302
           |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   tggaggatgaatcaatttacacctgcgatcactgtcagcaggacttcgagtctctggcag 61

                                              
Query: 303 acctgacggaccaccgggcccaccgctgtcctgga 337
           |||||||||||||||||||||||||||||||||||
Sbjct: 62  acctgacggaccaccgggcccaccgctgtcctgga 96
























[ summary ]

>|BF012461.1|10712736| ux56f04.y1 Soares_NKWMD_mandible Mus musculus
           cDNA clone IMAGE:3514303 5' similar to TR:O94860 O94860
           KIAA0760 PROTEIN ;, mRNA sequence
          Length = 546

 Score =  141 bits (71), Expect = 3e-31
 Identities = 71/71 (100%)
 Strand = Plus / Plus

                                                                       
Query: 267 gcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccacc 326
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcgatcactgtcagcaggacttcgagtctctggcagacctgacggaccaccgggcccacc 60

                      
Query: 327 gctgtcctgga 337
           |||||||||||
Sbjct: 61  gctgtcctgga 71
























[ summary ]

>|AC127285.4|51854735|Mus musculus BAC clone RP23-336P20 from chromosome
              8, complete sequence.
          Length = 232127

 Score =  125 bits (63), Expect = 7e-26
 Identities = 63/63 (100%)
 Strand = Plus / Plus

                                                                          
Query: 76     agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 135
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 214493 agttgaagagggggaggcctcggacttctcgctggcctgggattcctctgtggcagcagc 214552

                 
Query: 136    agg 138
              |||
Sbjct: 214553 agg 214555



 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                                
Query: 28     agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaag 77
              ||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 159797 agccccggacatgtccaggcggaagcaggcgaagccgcgatcggtgaaag 159846
























[ summary ]

>|CF539414.1|34591793| UI-M-GH0-chr-l-19-0-UI.r1 NIH_BMAP_GH0 Mus
           musculus cDNA clone IMAGE:30532410 5', mRNA sequence
          Length = 726

 Score =  115 bits (58), Expect = 1e-23
 Identities = 58/58 (100%)
 Strand = Plus / Plus

                                                                     
Query: 280 gcaggacttcgagtctctggcagacctgacggaccaccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcaggacttcgagtctctggcagacctgacggaccaccgggcccaccgctgtcctgga 58
























[ summary ]

>|CN703198.1|47471947| E0472G09-5 NIA Mouse E11.5 whole embryo cDNA
           library (Long) Mus musculus cDNA clone NIA:E0472G09
           IMAGE:30875504 5', mRNA sequence
          Length = 637

 Score =  111 bits (56), Expect = 2e-22
 Identities = 56/56 (100%)
 Strand = Plus / Plus

                                                                   
Query: 282 aggacttcgagtctctggcagacctgacggaccaccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   aggacttcgagtctctggcagacctgacggaccaccgggcccaccgctgtcctgga 58
























[ summary ]

>|CN698290.1|47467039| E0405G04-5 NIA Mouse E11.5 whole embryo cDNA
           library (Long) Mus musculus cDNA clone NIA:E0405G04
           IMAGE:30869067 5', mRNA sequence
          Length = 542

 Score =  111 bits (56), Expect = 2e-22
 Identities = 56/56 (100%)
 Strand = Plus / Plus

                                                                   
Query: 282 aggacttcgagtctctggcagacctgacggaccaccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   aggacttcgagtctctggcagacctgacggaccaccgggcccaccgctgtcctgga 58
























[ summary ]

>|AC007603.5|29366931|Homo sapiens chromosome 16 clone RP11-305A4,
              complete sequence.
          Length = 196927

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                                
Query: 28     agccccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaag 77
              ||||||||||||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 163226 agccccggacatgtccaggcggaagcaggcgaagccgcgctcggtgaaag 163275



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 0/57 (0%)
 Strand = Plus / Plus

                                                                   
Query: 31 cccggacatgtccaggcggaagcaggcgaanccgcgatcggtgaaagttgaagaggg 87
























[ summary ]

>|CF532954.1|34584922| UI-M-FY0-cgr-d-19-0-UI.r1 NIH_BMAP_FY0 Mus
           musculus cDNA clone IMAGE:30363066 5', mRNA sequence
          Length = 709

 Score = 79.8 bits (40), Expect = 8e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 298 ggcagacctgacggaccaccgggcccaccgctgtcctgga 337
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggcagacctgacggaccaccgggcccaccgctgtcctgga 40