W027B03 - 02018
Sequences producing significant alignments: Score E
(bits) Value
NM  |NM_028603.1|21312079| Mus musculus RIKEN cDNA 2410081M15 gene  214   8e-55
NT  |NT_109317.1|63512389|Mus musculus chromosome 4 genomic contig  214   2e-53
EST |CJ153141.1|76257280| CJ153141 RIKEN full-length enriched mous  214   2e-53
EST |CJ151692.1|76255831| CJ151692 RIKEN full-length enriched mous  214   2e-53
EST |CJ080546.1|76180815| CJ080546 RIKEN full-length enriched mous  214   2e-53
EST |CJ078010.1|76178248| CJ078010 RIKEN full-length enriched mous  214   2e-53
EST |CX238700.1|56893992| NMA06370 Mus Musculus Lateral Ventricle   214   2e-53
EST |CN671108.1|47437559| A0901H01-5 NIA Mouse Embryonic Stem (ES)  214   2e-53
EST |CK389213.1|40379443| L0940B05-5 NIA Mouse Newborn Kidney cDNA  214   2e-53
EST |BY710168.1|27121385| BY710168 RIKEN full-length enriched, ES   214   2e-53
EST |AI643135.1|4721610| mm58e02.y1 Stratagene mouse embryonic car  214   2e-53
EST |AA068523.1|1575884| mm58e02.r1 Stratagene mouse embryonic car  214   2e-53
NR  |AL607123.22|20338464|Mouse DNA sequence from clone RP23-391E6  214   7e-53
EST |CJ085466.1|76185736| CJ085466 RIKEN full-length enriched mous  212   6e-53
EST |CN689154.1|47455600| E0271E07-5 NIA Mouse Embryonic Stem (ES)  212   6e-53
EST |BY024736.1|26130179| BY024736 RIKEN full-length enriched, mam  208   9e-52
EST |BY023413.1|26128856| BY023413 RIKEN full-length enriched, mam  208   9e-52
EST |BY022612.1|26128055| BY022612 RIKEN full-length enriched, mam  208   9e-52
EST |CJ088293.1|76188563| CJ088293 RIKEN full-length enriched mous  206   4e-51
EST |BY068891.1|26172017| BY068891 RIKEN full-length enriched, 17   206   4e-51
EST |CJ086956.1|76187226| CJ086956 RIKEN full-length enriched mous  200   2e-49
EST |CJ084985.1|76185255| CJ084985 RIKEN full-length enriched mous  200   2e-49
EST |BY029149.1|26134592| BY029149 RIKEN full-length enriched, mam  194   1e-47
EST |CJ086970.1|76187240| CJ086970 RIKEN full-length enriched mous  192   6e-47
EST |BQ895750.1|22287764| AGENCOURT_8753076 NIH_MGC_130 Mus muscul  190   2e-46
EST |BY734758.1|27147885| BY734758 RIKEN full-length enriched, mam  186   3e-45
EST |CA750262.1|25574949| UI-M-FD0-cdh-b-11-0-UI.r1 NIH_BMAP_FD0 M  186   3e-45
EST |BY028631.1|26134074| BY028631 RIKEN full-length enriched, mam  184   1e-44
EST |CJ152626.1|76256765| CJ152626 RIKEN full-length enriched mous  182   5e-44
EST |CJ074001.1|76174097| CJ074001 RIKEN full-length enriched mous  149   8e-34
EST |CX730315.1|58032788| oc01g05.y1 No3 mouse (cataract/retinal d  145   1e-32
EST |CB194807.1|28219999| AGENCOURT_11259613 NIH_MGC_135 Mus muscu  141   2e-31
EST |BG866720.1|14217260| 602786524F1 NCI_CGAP_SG2 Mus musculus cD  139   7e-31
NR  |BC017614.1|17160888|Mus musculus RIKEN cDNA 2410081M15 gene,   139   3e-30
EST |BQ572827.1|21476144| UI-M-FD0-byf-o-24-0-UI.r1 NIH_BMAP_FD0 M  133   5e-29
EST |CJ153248.1|76257387| CJ153248 RIKEN full-length enriched mous  129   7e-28
EST |BG961874.1|14349511| 602826541F1 NCI_CGAP_Co24 Mus musculus c  123   4e-26
EST |CF895252.1|38162301| A0145G02-5 NIA Mouse Undifferentiated ES  109   7e-22
EST |BB607839.1|11561705| BB607839 RIKEN full-length enriched, 2 d  109   7e-22
EST |CV676753.1|54886029| ie45e12.k1 Kaestner ngn3 wt Mus musculus  105   1e-20
EST |CF166874.1|33276428| B0777B02-5 NIA Mouse Embryonic Germ Cell  105   1e-20
EST |BY066920.1|26170494| BY066920 RIKEN full-length enriched, 17   105   1e-20
EST |BY063024.1|26167770| BY063024 RIKEN full-length enriched, 17   105   1e-20
EST |BY059746.1|26165194| BY059746 RIKEN full-length enriched, 17   105   1e-20
EST |DN176113.1|60271360| NMB02095 Mus Musculus Lateral Ventricle   103   4e-20
NM  |NM_001040441.1|94721341| Homo sapiens zinc finger and BTB dom  100   3e-20
NM  |XM_001124597.1|113412017| PREDICTED: Homo sapiens similar to   100   3e-20
NR  |AL033529.25|10834542|Human DNA sequence from clone RP1-27O5 o  100   3e-18
EST |CF163799.1|33273348| B0733C03-5 NIA Mouse Embryonic Germ Cell   98   2e-18
NR  |AK074546.1|22760055|Homo sapiens cDNA FLJ90065 fis, clone HEM   98   1e-17
NR  |AY157873.1|26245404|Homo sapiens BTB/POZ and zinc-finger doma   96   5e-17
EST |BY344082.1|26573570| BY344082 RIKEN full-length enriched, who   90   6e-16
EST |CN672126.1|47438577| A0915F08-5 NIA Mouse Embryonic Stem (ES)   88   2e-15
NR  |BC120135.1|111307065|Bos taurus similar to zinc finger and BT   86   4e-14
EST |BI664340.1|15578573| 603289902F1 NCI_CGAP_Mam6 Mus musculus c   84   4e-14






















[ summary ]

>|NM_028603.1|21312079| Mus musculus RIKEN cDNA 2410081M15 gene
           (2410081M15Rik), mRNA
          Length = 2228

 Score =  214 bits (108), Expect = 8e-55
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 109 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 168

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 169 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 228

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 229 gaatcgctccgc 240



 Score =  105 bits (53), Expect = 5e-22
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 275 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 334

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 335 gcccttcagc 344
























[ summary ]

>|NT_109317.1|63512389|Mus musculus chromosome 4 genomic contig, strain
               C57BL/6J
          Length = 7941585

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Minus

                                                                           
Query: 5       gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
               |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 6970260 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 6970201

                                                                           
Query: 65      ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6970200 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 6970141

                           
Query: 125     gaatcgctccgc 136
               ||||||||||||
Sbjct: 6970140 gaatcgctccgc 6970129



 Score = 83.8 bits (42), Expect = 4e-14
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                 
Query: 185     cgctgttcgtgaactccttgacttagagtccttcctctttgcccttcagc 234
               |||||||||||||||  |||||||||||||||||||||||||||||||||
Sbjct: 6961655 cgctgttcgtgaacttgttgacttagagtccttcctctttgcccttcagc 6961606
























[ summary ]

>|CJ153141.1|76257280| CJ153141 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J visual cortex Mus musculus cDNA
           clone K430317L23 5', mRNA sequence
          Length = 413

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 45  gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 104

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 105 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 164

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 165 gaatcgctccgc 176



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 213 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 272

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 273 gcccttcagc 282
























[ summary ]

>|CJ151692.1|76255831| CJ151692 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J visual cortex Mus musculus cDNA
           clone K430037H02 5', mRNA sequence
          Length = 443

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 45  gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 104

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 105 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 164

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 165 gaatcgctccgc 176



 Score = 77.8 bits (39), Expect = 2e-12
 Identities = 58/64 (90%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccccgcgacannncgctgttcgtgaactccttgacttagagt-ccttcctctttgccctt 230
           ||||||||||   |||||||||||||||  |||||||||||| |||||||||||||||||
Sbjct: 221 ccccgcgacactccgctgttcgtgaacttgttgacttagagtcccttcctctttgccctt 280

               
Query: 231 cagc 234
           ||||
Sbjct: 281 cagc 284
























[ summary ]

>|CJ080546.1|76180815| CJ080546 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020053A06 5', mRNA sequence
          Length = 383

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 159 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 218

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 278

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 279 gaatcgctccgc 290



 Score = 69.9 bits (35), Expect = 6e-10
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcct 220
           |||||||||||||||||   |||||||||||||||  |||||||| ||||||||||
Sbjct: 327 gctagagccccgcgacactccgctgttcgtgaacttgttgacttacagtccttcct 382
























[ summary ]

>|CJ078010.1|76178248| CJ078010 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020037H22 5', mRNA sequence
          Length = 368

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 159 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 218

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 278

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 279 gaatcgctccgc 290
























[ summary ]

>|CX238700.1|56893992| NMA06370 Mus Musculus Lateral Ventricle Wall
           C57BL/6 adult Mus musculus cDNA 5', mRNA sequence
          Length = 864

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 44  gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 103

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 163

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 164 gaatcgctccgc 175



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 212 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 271

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 272 gcccttcagc 281
























[ summary ]

>|CN671108.1|47437559| A0901H01-5 NIA Mouse Embryonic Stem (ES) cell
           (Lif+, 48 h, high density) cDNA library (Long) Mus
           musculus cDNA clone NIA:A0901H01 IMAGE:30766932 5', mRNA
           sequence
          Length = 533

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 159 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 218

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 278

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 279 gaatcgctccgc 290



 Score = 97.6 bits (49), Expect = 2e-18
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 319 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 378

                     
Query: 225 gcccttcagc 234
           |||| |||||
Sbjct: 379 gcccctcagc 388
























[ summary ]

>|CK389213.1|40379443| L0940B05-5 NIA Mouse Newborn Kidney cDNA
           Library (Long) Mus musculus cDNA clone NIA:L0940B05
           IMAGE:30003856 5', mRNA sequence
          Length = 437

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 196 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 255

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 256 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 315

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 316 gaatcgctccgc 327



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 364 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 423

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 424 gcccttcagc 433
























[ summary ]

>|BY710168.1|27121385| BY710168 RIKEN full-length enriched, ES cells
           Mus musculus cDNA clone 2410081M15 5', mRNA sequence
          Length = 1021

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 106 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 165

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 225

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 226 gaatcgctccgc 237



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 272 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 331

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 332 gcccttcagc 341
























[ summary ]

>|AI643135.1|4721610| mm58e02.y1 Stratagene mouse embryonic
           carcinoma (#937317) Mus musculus cDNA clone IMAGE:532634
           5', mRNA sequence
          Length = 387

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 55  gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 114

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 115 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 174

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 175 gaatcgctccgc 186



 Score =  109 bits (55), Expect = 7e-22
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 211 gctagagccccgcgacaatccgctgttcgtgaacttgttgacttagagtccttcctcttt 270

                       
Query: 225 gcccttcagcag 236
           ||||||||||||
Sbjct: 271 gcccttcagcag 282
























[ summary ]

>|AA068523.1|1575884| mm58e02.r1 Stratagene mouse embryonic
           carcinoma (#937317) Mus musculus cDNA clone IMAGE:532634
           5' similar to TR:G1063670 G1063670 ZINC FINGER PROTEIN
           C2H2-171. ;, mRNA sequence
          Length = 445

 Score =  214 bits (108), Expect = 2e-53
 Identities = 126/132 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 55  gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 114

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 115 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 174

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 175 gaatcgctccgc 186



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 167 tagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctctttgc 226
           |||||||||||||||   |||||||||||||||  |||||||||||||||||||||||||
Sbjct: 213 tagagccccgcgacaatccgctgttcgtgaacttgttgacttagagtccttcctctttgc 272

                     
Query: 227 ccttcagcag 236
           ||||||||||
Sbjct: 273 ccttcagcag 282
























[ summary ]

>|AL607123.22|20338464|Mouse DNA sequence from clone RP23-391E6 on
              chromosome 4, complete sequence.
          Length = 149369

 Score =  214 bits (108), Expect = 7e-53
 Identities = 126/132 (95%)
 Strand = Plus / Minus

                                                                          
Query: 5      gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
              |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 126906 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 126847

                                                                          
Query: 65     ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126846 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 126787

                          
Query: 125    gaatcgctccgc 136
              ||||||||||||
Sbjct: 126786 gaatcgctccgc 126775



 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                
Query: 185    cgctgttcgtgaactccttgacttagagtccttcctctttgcccttcagc 234
              |||||||||||||||  |||||||||||||||||||||||||||||||||
Sbjct: 118301 cgctgttcgtgaacttgttgacttagagtccttcctctttgcccttcagc 118252
























[ summary ]

>|CJ085466.1|76185736| CJ085466 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020082E23 5', mRNA sequence
          Length = 398

 Score =  212 bits (107), Expect = 6e-53
 Identities = 125/131 (95%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 159 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 218

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 278

                      
Query: 125 gaatcgctccg 135
           |||||||||||
Sbjct: 279 gaatcgctccg 289



 Score = 99.6 bits (50), Expect = 6e-19
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||| ||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 327 gctagagccccgngacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 386

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 387 gcccttcagc 396
























[ summary ]

>|CN689154.1|47455600| E0271E07-5 NIA Mouse Embryonic Stem (ES) cell
           (Lif-, 48 h, high density) cDNA library (Long) Mus
           musculus cDNA clone NIA:E0271E07 IMAGE:30856182 5', mRNA
           sequence
          Length = 561

 Score =  212 bits (107), Expect = 6e-53
 Identities = 107/107 (100%)
 Strand = Plus / Plus

                                                                       
Query: 30  gcaaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggc 89
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8   gcaaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggc 67

                                                          
Query: 90  ttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 68  ttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 114



 Score =  109 bits (55), Expect = 7e-22
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 143 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 202

                       
Query: 225 gcccttcagcag 236
           ||||||||||||
Sbjct: 203 gcccttcagcag 214
























[ summary ]

>|BY024736.1|26130179| BY024736 RIKEN full-length enriched, mammary
           gland RCB-0527 Jyg-MC(B) cDNA Mus musculus cDNA clone
           G930024J20 5', mRNA sequence
          Length = 380

 Score =  208 bits (105), Expect = 9e-52
 Identities = 105/105 (100%)
 Strand = Plus / Plus

                                                                       
Query: 32  aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 91
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 62

                                                        
Query: 92  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 63  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 107



 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||| ||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 132 gctacagccccgcgacaatccgctgttcgtgaacttgttgacttagagtccttcctcttt 191

                   
Query: 225 gcccttca 232
           ||||||||
Sbjct: 192 gcccttca 199
























[ summary ]

>|BY023413.1|26128856| BY023413 RIKEN full-length enriched, mammary
           gland RCB-0527 Jyg-MC(B) cDNA Mus musculus cDNA clone
           G930016L20 5', mRNA sequence
          Length = 381

 Score =  208 bits (105), Expect = 9e-52
 Identities = 105/105 (100%)
 Strand = Plus / Plus

                                                                       
Query: 32  aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 91
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 62

                                                        
Query: 92  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 63  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 107



 Score =  109 bits (55), Expect = 7e-22
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 132 gctagagccccgcgacaatccgctgttcgtgaacttgttgacttagagtccttcctcttt 191

                       
Query: 225 gcccttcagcag 236
           ||||||||||||
Sbjct: 192 gcccttcagcag 203
























[ summary ]

>|BY022612.1|26128055| BY022612 RIKEN full-length enriched, mammary
           gland RCB-0527 Jyg-MC(B) cDNA Mus musculus cDNA clone
           G930013A05 5', mRNA sequence
          Length = 381

 Score =  208 bits (105), Expect = 9e-52
 Identities = 105/105 (100%)
 Strand = Plus / Plus

                                                                       
Query: 32  aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 91
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 62

                                                        
Query: 92  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 63  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 107



 Score =  109 bits (55), Expect = 7e-22
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 132 gctagagccccgcgacaatccgctgttcgtgaacttgttgacttagagtccttcctcttt 191

                       
Query: 225 gcccttcagcag 236
           ||||||||||||
Sbjct: 192 gcccttcagcag 203
























[ summary ]

>|CJ088293.1|76188563| CJ088293 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020099O14 5', mRNA sequence
          Length = 362

 Score =  206 bits (104), Expect = 4e-51
 Identities = 125/132 (94%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||| 
Sbjct: 159 gcgtttctgtccaacgcccacgttagcaaataccttttgtttctcccacgttggggctat 218

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 278

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 279 gaatcgctccgc 290
























[ summary ]

>|BY068891.1|26172017| BY068891 RIKEN full-length enriched, 17 days
           pregnant adult female amnion Mus musculus cDNA clone
           I920062O04 5', mRNA sequence
          Length = 379

 Score =  206 bits (104), Expect = 4e-51
 Identities = 106/107 (99%)
 Strand = Plus / Plus

                                                                       
Query: 30  gcaaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggc 89
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 266 gcaaatancttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggc 325

                                                          
Query: 90  ttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 ttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 372
























[ summary ]

>|CJ086956.1|76187226| CJ086956 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020091A05 5', mRNA sequence
          Length = 379

 Score =  200 bits (101), Expect = 2e-49
 Identities = 104/105 (99%)
 Strand = Plus / Plus

                                                                       
Query: 32  aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 91
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 186 aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 245

                                                        
Query: 92  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           ||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 246 cggaaaggggctggttcccctacccggaaccgggaatcgctccgc 290



 Score = 65.9 bits (33), Expect = 9e-09
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtcctt 217
           |||||||||||||||||   |||||||||||||||  | ||||||||||||||
Sbjct: 327 gctagagccccgcgacactccgctgttcgtgaacttgtngacttagagtcctt 379
























[ summary ]

>|CJ084985.1|76185255| CJ084985 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020079I17 5', mRNA sequence
          Length = 390

 Score =  200 bits (101), Expect = 2e-49
 Identities = 126/133 (94%), Gaps = 1/133 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||||||||||||||||||||||||||
Sbjct: 159 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctcccacgttggggctac 218

                                                                       
Query: 65  ttgttttagggcgcaaag-cctcggcttcggaaaggggctgcttcccctacccggaaccg 123
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 ttgttttagggcgcaaagccctcggcttcggaaaggggctgcttcccctacccggaaccg 278

                        
Query: 124 ggaatcgctccgc 136
           |||||||||||||
Sbjct: 279 ggaatcgctccgc 291



 Score = 91.7 bits (46), Expect = 2e-16
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 328 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 387

              
Query: 225 gcc 227
           |||
Sbjct: 388 gcc 390
























[ summary ]

>|BY029149.1|26134592| BY029149 RIKEN full-length enriched, mammary
           gland RCB-0527 Jyg-MC(B) cDNA Mus musculus cDNA clone
           G930105C09 5', mRNA sequence
          Length = 357

 Score =  194 bits (98), Expect = 1e-47
 Identities = 105/106 (99%), Gaps = 1/106 (0%)
 Strand = Plus / Plus

                                                                       
Query: 32  aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 91
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 62

                                                         
Query: 92  cggaaaggggctgctt-cccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 63  cggaaaggggctgcttccccctacccggaaccgggaatcgctccgc 108



 Score =  103 bits (52), Expect = 4e-20
 Identities = 66/72 (91%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           ||||||||||||||| |   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 133 gctagagccccgcganaatccgctgttcgtgaacttgttgacttagagtccttcctcttt 192

                       
Query: 225 gcccttcagcag 236
           ||||||||||||
Sbjct: 193 gcccttcagcag 204
























[ summary ]

>|CJ086970.1|76187240| CJ086970 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020091B06 5', mRNA sequence
          Length = 379

 Score =  192 bits (97), Expect = 6e-47
 Identities = 123/132 (93%)
 Strand = Plus / Plus

                                                                       
Query: 5   gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
           |||||||| | ||||||||| |   |||||||||||| ||||||||||||||||||||||
Sbjct: 159 gcgtttctgtccaacgcccacgttagcaaatacctttggtttctcccacgttggggctac 218

                                                                       
Query: 65  ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgg 124
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||
Sbjct: 219 ttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccgganacgg 278

                       
Query: 125 gaatcgctccgc 136
           ||||||||||||
Sbjct: 279 gaatcgctccgc 290



 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtcctt 217
           |||||||||||||||||   |||||||||||||||  ||||||||||||||||
Sbjct: 327 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtcctt 379
























[ summary ]

>|BQ895750.1|22287764| AGENCOURT_8753076 NIH_MGC_130 Mus musculus
           cDNA clone IMAGE:6394610 5', mRNA sequence
          Length = 966

 Score =  190 bits (96), Expect = 2e-46
 Identities = 103/104 (99%), Gaps = 1/104 (0%)
 Strand = Plus / Plus

                                                                       
Query: 33  aataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggcttc 92
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   aataccttttgtttctccc-cgttggggctacttgttttagggcgcaaagcctcggcttc 59

                                                       
Query: 93  ggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 60  ggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 103



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 140 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 199

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 200 gcccttcagc 209
























[ summary ]

>|BY734758.1|27147885| BY734758 RIKEN full-length enriched, mammary
           gland RCB-0526 Jyg-MC(A) cDNA Mus musculus cDNA clone
           G830024D01 5', mRNA sequence
          Length = 657

 Score =  186 bits (94), Expect = 3e-45
 Identities = 97/98 (98%)
 Strand = Plus / Plus

                                                                       
Query: 39  ttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggcttcggaaag 98
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggcttcggaaag 60

                                                 
Query: 99  gggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||| |||||||||||||||||||
Sbjct: 61  gggctgcttcccctaccctgaaccgggaatcgctccgc 98



 Score =  109 bits (55), Expect = 7e-22
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 123 gctagagccccgcgacaatccgctgttcgtgaacttgttgacttagagtccttcctcttt 182

                       
Query: 225 gcccttcagcag 236
           ||||||||||||
Sbjct: 183 gcccttcagcag 194
























[ summary ]

>|CA750262.1|25574949| UI-M-FD0-cdh-b-11-0-UI.r1 NIH_BMAP_FD0 Mus
           musculus cDNA clone IMAGE:6828684 5', mRNA sequence
          Length = 785

 Score =  186 bits (94), Expect = 3e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 43  gtttctcccacgttggggctacttgttttagggcgcaaagcctcggcttcggaaaggggc 102
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gtttctcccacgttggggctacttgttttagggcgcaaagcctcggcttcggaaaggggc 60

                                             
Query: 103 tgcttcccctacccggaaccgggaatcgctccgc 136
           ||||||||||||||||||||||||||||||||||
Sbjct: 61  tgcttcccctacccggaaccgggaatcgctccgc 94



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 131 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 190

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 191 gcccttcagc 200
























[ summary ]

>|BY028631.1|26134074| BY028631 RIKEN full-length enriched, mammary
           gland RCB-0527 Jyg-MC(B) cDNA Mus musculus cDNA clone
           G930050F13 5', mRNA sequence
          Length = 360

 Score =  184 bits (93), Expect = 1e-44
 Identities = 102/105 (97%)
 Strand = Plus / Plus

                                                                       
Query: 32  aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggctt 91
           |||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 3   aaatacctttggtttctcccacgtgggggctactggttttagggcgcaaagcctcggctt 62

                                                        
Query: 92  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 63  cggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 107



 Score = 97.6 bits (49), Expect = 2e-18
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                       
Query: 167 tagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctctttgc 226
           |||||||||||||||   |||||||||||||||  |||||||||||||||||||||| ||
Sbjct: 134 tagagccccgcgacaatccgctgttcgtgaactggttgacttagagtccttcctcttggc 193

                     
Query: 227 ccttcagcag 236
           ||||||||||
Sbjct: 194 ccttcagcag 203
























[ summary ]

>|CJ152626.1|76256765| CJ152626 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J visual cortex Mus musculus cDNA
           clone K430304F08 5', mRNA sequence
          Length = 452

 Score =  182 bits (92), Expect = 5e-44
 Identities = 103/107 (96%)
 Strand = Plus / Plus

                                                                       
Query: 30  gcaaataccttttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggc 89
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 70  gcaaataccttttgtttctcccacgttggggctacttgtnttagggcgcaaagcctcggc 129

                                                          
Query: 90  ttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 130 ttcggaaaggggctgcttaccctaaccggaaccgggaattgctccgc 176
























[ summary ]

>|CJ074001.1|76174097| CJ074001 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J whole body 5 days embryo Mus
           musculus cDNA clone I020012J04 5', mRNA sequence
          Length = 384

 Score =  149 bits (75), Expect = 8e-34
 Identities = 94/98 (95%), Gaps = 2/98 (2%)
 Strand = Plus / Plus

                                                                       
Query: 40  tttgtttctcccacgttggggctacttgttttagggcgcaaagcctcggcttcggaaagg 99
           ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 192 tttgtttctcccangttggggctaattgttttagggcgcaaagcctcggcttcggaaagg 251

                                                 
Query: 100 ggctgcttcccct-acccggaaccgggaatcgctccgc 136
           ||||||||||||| |||||||| |||||||||||||||
Sbjct: 252 ggctgcttcccctaacccggaa-cgggaatcgctccgc 288



 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 167 tagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 327 tagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 384
























[ summary ]

>|CX730315.1|58032788| oc01g05.y1 No3 mouse (cataract/retinal
           degeneration) whole eye, unamplified: ob/oc Mus musculus
           cDNA clone oc01g05 5', mRNA sequence
          Length = 629

 Score =  145 bits (73), Expect = 1e-32
 Identities = 73/73 (100%)
 Strand = Plus / Plus

                                                                       
Query: 64  cttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccg 123
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccg 60

                        
Query: 124 ggaatcgctccgc 136
           |||||||||||||
Sbjct: 61  ggaatcgctccgc 73



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 110 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 169

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 170 gcccttcagc 179
























[ summary ]

>|CB194807.1|28219999| AGENCOURT_11259613 NIH_MGC_135 Mus musculus
           cDNA clone IMAGE:30136194 5', mRNA sequence
          Length = 896

 Score =  141 bits (71), Expect = 2e-31
 Identities = 71/71 (100%)
 Strand = Plus / Plus

                                                                       
Query: 66  tgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccggg 125
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccggg 60

                      
Query: 126 aatcgctccgc 136
           |||||||||||
Sbjct: 61  aatcgctccgc 71



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 108 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 167

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 168 gcccttcagc 177
























[ summary ]

>|BG866720.1|14217260| 602786524F1 NCI_CGAP_SG2 Mus musculus cDNA
           clone IMAGE:4912757 5', mRNA sequence
          Length = 952

 Score =  139 bits (70), Expect = 7e-31
 Identities = 70/70 (100%)
 Strand = Plus / Plus

                                                                       
Query: 67  gttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccggga 126
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccggga 60

                     
Query: 127 atcgctccgc 136
           ||||||||||
Sbjct: 61  atcgctccgc 70



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 107 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 166

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 167 gcccttcagc 176
























[ summary ]

>|BC017614.1|17160888|Mus musculus RIKEN cDNA 2410081M15 gene, mRNA
           (cDNA clone MGC:27680 IMAGE:4912757), complete cds.
          Length = 2131

 Score =  139 bits (70), Expect = 3e-30
 Identities = 70/70 (100%)
 Strand = Plus / Plus

                                                                       
Query: 67  gttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccggga 126
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccggga 60

                     
Query: 127 atcgctccgc 136
           ||||||||||
Sbjct: 61  atcgctccgc 70



 Score =  105 bits (53), Expect = 5e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 107 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 166

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 167 gcccttcagc 176
























[ summary ]

>|BQ572827.1|21476144| UI-M-FD0-byf-o-24-0-UI.r1 NIH_BMAP_FD0 Mus
           musculus cDNA clone IMAGE:5717615 5', mRNA sequence
          Length = 737

 Score =  133 bits (67), Expect = 5e-29
 Identities = 81/83 (97%), Gaps = 2/83 (2%)
 Strand = Plus / Plus

                                                                       
Query: 56  tggggctacttg-tttta-gggcgcaaagcctcggcttcggaaaggggctgcttccccta 113
           |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 5   tggggctacttggttttacgggcgcaaagcctcggcttcggaaaggggctgcttccccta 64

                                  
Query: 114 cccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||
Sbjct: 65  cccggaaccgggaatcgctccgc 87



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 124 gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 183

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 184 gcccttcagc 193
























[ summary ]

>|CJ153248.1|76257387| CJ153248 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J visual cortex Mus musculus cDNA
           clone K430321P06 5', mRNA sequence
          Length = 388

 Score =  129 bits (65), Expect = 7e-28
 Identities = 65/65 (100%)
 Strand = Plus / Plus

                                                                       
Query: 72  agggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgggaatcgc 131
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   agggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgggaatcgc 61

                
Query: 132 tccgc 136
           |||||
Sbjct: 62  tccgc 66



 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||| ||||||||||||   |||||||||||||||  ||||||||||| |||||||||||
Sbjct: 103 gctacagccccgcgacactccgctgttcgtgaacttgttgacttagagcccttcctcttt 162

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 163 gcccttcagc 172
























[ summary ]

>|BG961874.1|14349511| 602826541F1 NCI_CGAP_Co24 Mus musculus cDNA
           clone IMAGE:4981163 5', mRNA sequence
          Length = 819

 Score =  123 bits (62), Expect = 4e-26
 Identities = 62/62 (100%)
 Strand = Plus / Plus

                                                                       
Query: 75  gcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgggaatcgctcc 134
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10  gcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaaccgggaatcgctcc 69

             
Query: 135 gc 136
           ||
Sbjct: 70  gc 71



 Score = 97.6 bits (49), Expect = 2e-18
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  | |||||||||||||||||||||
Sbjct: 108 gctagagccccgcgacactccgctgttcgtgaacttgtcgacttagagtccttcctcttt 167

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 168 gcccttcagc 177
























[ summary ]

>|CF895252.1|38162301| A0145G02-5 NIA Mouse Undifferentiated ES Cell
           cDNA Library (Long 1) Mus musculus cDNA clone
           NIA:A0145G02 IMAGE:30727945 5', mRNA sequence
          Length = 608

 Score =  109 bits (55), Expect = 7e-22
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 66  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 125

                       
Query: 225 gcccttcagcag 236
           ||||||||||||
Sbjct: 126 gcccttcagcag 137



 Score = 73.8 bits (37), Expect = 4e-11
 Identities = 37/37 (100%)
 Strand = Plus / Plus

                                                
Query: 100 ggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggctgcttcccctacccggaaccgggaatcgctccgc 37
























[ summary ]

>|BB607839.1|11561705| BB607839 RIKEN full-length enriched, 2 days
           pregnant adult female oviduct Mus musculus cDNA clone
           E230007P13 5', mRNA sequence
          Length = 294

 Score =  109 bits (55), Expect = 7e-22
 Identities = 70/75 (93%)
 Strand = Plus / Plus

                                                                       
Query: 62  tacttgttttagggcgcaaagcctcggcttcggaaaggggctgcttcccctacccggaac 121
           ||||| |||||||| |||||||||||| |||||||||||| || ||||||||||||||||
Sbjct: 4   tactttttttagggggcaaagcctcgggttcggaaagggggtggttcccctacccggaac 63

                          
Query: 122 cgggaatcgctccgc 136
           |||||||||||||||
Sbjct: 64  cgggaatcgctccgc 78



 Score = 77.8 bits (39), Expect = 2e-12
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 167 tagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctctttgc 226
           |||||||||||||||   |||||||||||||||  || | ||||||||||||||||||| 
Sbjct: 117 tagagccccgcgacactccgctgttcgtgaacttgttaaattagagtccttcctctttgg 176

                   
Query: 227 ccttcagc 234
           ||||||||
Sbjct: 177 ccttcagc 184
























[ summary ]

>|CV676753.1|54886029| ie45e12.k1 Kaestner ngn3 wt Mus musculus cDNA
           5', mRNA sequence
          Length = 309

 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 23  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 82

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 83  gcccttcagc 92
























[ summary ]

>|CF166874.1|33276428| B0777B02-5 NIA Mouse Embryonic Germ Cell cDNA
           Library (Long) Mus musculus cDNA clone NIA:B0777B02
           IMAGE:30465229 5', mRNA sequence
          Length = 290

 Score =  105 bits (53), Expect = 1e-20
 Identities = 53/53 (100%)
 Strand = Plus / Plus

                                                                
Query: 84  ctcggcttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ctcggcttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 53



 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 88  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 147

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 148 gcccttcagc 157
























[ summary ]

>|BY066920.1|26170494| BY066920 RIKEN full-length enriched, 17 days
           embryo kidney Mus musculus cDNA clone I920051I20 5',
           mRNA sequence
          Length = 373

 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 11  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 70

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 71  gcccttcagc 80
























[ summary ]

>|BY063024.1|26167770| BY063024 RIKEN full-length enriched, 17 days
           embryo kidney Mus musculus cDNA clone I920025H12 5',
           mRNA sequence
          Length = 361

 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 11  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 70

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 71  gcccttcagc 80
























[ summary ]

>|BY059746.1|26165194| BY059746 RIKEN full-length enriched, 17 days
           embryo kidney Mus musculus cDNA clone I920003E18 5',
           mRNA sequence
          Length = 403

 Score =  105 bits (53), Expect = 1e-20
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||||||||||||||
Sbjct: 11  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctcttt 70

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 71  gcccttcagc 80
























[ summary ]

>|DN176113.1|60271360| NMB02095 Mus Musculus Lateral Ventricle Wall
           C57BL/6 adult Mus musculus cDNA 5', mRNA sequence
          Length = 561

 Score =  103 bits (52), Expect = 4e-20
 Identities = 64/69 (92%)
 Strand = Plus / Plus

                                                                       
Query: 166 ctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctctttg 225
           ||||||||||||||||   |||||||||||||||  ||||||||||||||||||||||||
Sbjct: 1   ctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctctttg 60

                    
Query: 226 cccttcagc 234
           |||||||||
Sbjct: 61  cccttcagc 69
























[ summary ]

>|AL033529.25|10834542|Human DNA sequence from clone RP1-27O5 on
             chromosome 1p34.1-35.3, complete sequence.
          Length = 147167

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 71/78 (91%)
 Strand = Plus / Plus

                                                                         
Query: 5     gcgtttcttttcaacgcccaggggggcaaataccttttgtttctcccacgttggggctac 64
             |||||||| | ||||||||| |   |||||||||||||||||||| ||||||||||||||
Sbjct: 50544 gcgtttctgtccaacgcccacgtcagcaaataccttttgtttctctcacgttggggctac 50603

                               
Query: 65    ttgttttagggcgcaaag 82
             ||||||||||||||||||
Sbjct: 50604 ttgttttagggcgcaaag 50621
























[ summary ]

>|CF163799.1|33273348| B0733C03-5 NIA Mouse Embryonic Germ Cell cDNA
           Library (Long) Mus musculus cDNA clone NIA:B0733C03
           IMAGE:30461018 5', mRNA sequence
          Length = 173

 Score = 97.6 bits (49), Expect = 2e-18
 Identities = 52/53 (98%)
 Strand = Plus / Plus

                                                                
Query: 84  ctcggcttcggaaaggggctgcttcccctacccggaaccgggaatcgctccgc 136
           |||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ctcggcttcggagaggggctgcttcccctacccggaaccgggaatcgctccgc 53



 Score = 97.6 bits (49), Expect = 2e-18
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  ||||||||||||||||||||| |
Sbjct: 88  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagtccttcctctgt 147

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 148 gcccttcagc 157
























[ summary ]

>|AK074546.1|22760055|Homo sapiens cDNA FLJ90065 fis, clone
          HEMBA1003497, weakly similar to ZINC FINGER PROTEIN
          151.
          Length = 1920

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 52/53 (98%)
 Strand = Plus / Plus

                                                               
Query: 30 gcaaataccttttgtttctcccacgttggggctacttgttttagggcgcaaag 82
          |||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 2  gcaaataccttttgtttctctcacgttggggctacttgttttagggcgcaaag 54
























[ summary ]

>|AY157873.1|26245404|Homo sapiens BTB/POZ and zinc-finger domain
          containing factor variant L (BOZF1) mRNA, complete cds;
          alternatively spliced.
          Length = 1579

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                              
Query: 31 caaataccttttgtttctcccacgttggggctacttgttttagggcgcaaag 82
          ||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1  caaataccttttgtttctctcacgttggggctacttgttttagggcgcaaag 52
























[ summary ]

>|BY344082.1|26573570| BY344082 RIKEN full-length enriched, whole
           joints Mus musculus cDNA clone L730002D04 5', mRNA
           sequence
          Length = 336

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                       
Query: 165 gctagagccccgcgacannncgctgttcgtgaactccttgacttagagtccttcctcttt 224
           |||||||||||||||||   |||||||||||||||  |||||||||||  ||||||||||
Sbjct: 14  gctagagccccgcgacactccgctgttcgtgaacttgttgacttagagctcttcctcttt 73

                     
Query: 225 gcccttcagc 234
           ||||||||||
Sbjct: 74  gcccttcagc 83
























[ summary ]

>|CN672126.1|47438577| A0915F08-5 NIA Mouse Embryonic Stem (ES) cell
           (Lif+, 48 h, high density) cDNA library (Long) Mus
           musculus cDNA clone NIA:A0915F08 IMAGE:30768259 5', mRNA
           sequence
          Length = 586

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                               
Query: 185 cgctgttcgtgaactccttgacttagagtccttcctctttgcccttcagcag 236
           |||||||||||||||  |||||||||||||||||||||||||||||||||||
Sbjct: 68  cgctgttcgtgaacttgttgacttagagtccttcctctttgcccttcagcag 119
























[ summary ]

>|BC120135.1|111307065|Bos taurus similar to zinc finger and BTB
          domain containing 8, mRNA (cDNA clone MGC:142477
          IMAGE:8111433), complete cds.
          Length = 1935

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                             
Query: 32 aaataccttttgtttctcccacgttggggctacttgttttagggcgcaaag 82
          |||||||||||||||||| ||||||||||||||||||||| ||||||||||
Sbjct: 3  aaataccttttgtttctctcacgttggggctacttgttttggggcgcaaag 53
























[ summary ]

>|BI664340.1|15578573| 603289902F1 NCI_CGAP_Mam6 Mus musculus cDNA
           clone IMAGE:5323728 5', mRNA sequence
          Length = 876

 Score = 83.8 bits (42), Expect = 4e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 185 cgctgttcgtgaactccttgacttagagtccttcctctttgcccttcagc 234
           |||||||||||||||  |||||||||||||||||||||||||||||||||
Sbjct: 3   cgctgttcgtgaacttgttgacttagagtccttcctctttgcccttcagc 52