W174F05 - 10459
Sequences producing significant alignments: Score E
(bits) Value
EST |AV470352.1|140489389| AV470352 Abe mouse ES cell Mus musculus  186   4e-45
EST |EL604700.1|126098431| nbf06c11.q1 Mouse lens. Y2H (nbf) Mus m  186   4e-45
EST |CJ170466.1|76299202| CJ170466 RIKEN full-length enriched mous  186   4e-45
EST |CJ167790.1|76278277| CJ167790 RIKEN full-length enriched mous  186   4e-45
EST |CJ130896.1|76231224| CJ130896 RIKEN full-length enriched mous  186   4e-45
EST |DN175640.1|60270887| NMB05557 Mus Musculus Lateral Ventricle   186   4e-45
EST |BY773936.1|39700574| BY773936 RIKEN full-length enriched, 17.  186   4e-45
EST |CB951897.1|30207570| AGENCOURT_13597065 NIH_MGC_178 Mus muscu  186   4e-45
EST |BY287775.1|26478112| BY287775 RIKEN full-length enriched, vis  186   4e-45
EST |BY163260.1|26299906| BY163260 RIKEN full-length enriched, bon  186   4e-45
EST |BY162108.1|26298754| BY162108 RIKEN full-length enriched, bon  186   4e-45
EST |BY161114.1|26297760| BY161114 RIKEN full-length enriched, bon  186   4e-45
EST |BY100131.1|26210748| BY100131 RIKEN full-length enriched, poo  186   4e-45
EST |BY089715.1|26199059| BY089715 RIKEN full-length enriched, poo  186   4e-45
EST |BY067781.1|26171222| BY067781 RIKEN full-length enriched, 13   186   4e-45
EST |BY054940.1|26160388| BY054940 RIKEN full-length enriched, poo  186   4e-45
EST |BY036764.1|26142207| BY036764 RIKEN full-length enriched, poo  186   4e-45
EST |CA466104.1|24922456| AGENCOURT_10723593 NIH_MGC_169 Mus muscu  186   4e-45
EST |BU961568.1|24191140| AGENCOURT_10613948 NIH_MGC_169 Mus muscu  186   4e-45
EST |BU702179.1|23626725| UI-M-FI0-byr-a-05-0-UI.r1 NIH_BMAP_FI0 M  186   4e-45
EST |BQ895462.1|22287476| AGENCOURT_8751324 NIH_MGC_130 Mus muscul  186   4e-45
NT  |NT_039500.6|94388742|Mus musculus chromosome 10 genomic conti  186   5e-45
EST |CD541021.1|31588756| B0227G05-5 NIA Mouse Embryonic Germ Cell  180   3e-43
EST |BY309065.1|26499402| BY309065 RIKEN full-length enriched, str  180   3e-43
EST |AV490497.1|140539800| AV490497 Abe mouse ES cell Mus musculus  178   1e-42
EST |CJ162632.1|76273119| CJ162632 RIKEN full-length enriched mous  178   1e-42
EST |CN695529.1|47464278| E0366C12-5 NIA Mouse E10.5 whole embryo   178   1e-42
EST |BY168490.1|26305136| BY168490 RIKEN full-length enriched, bon  178   1e-42
EST |BY165835.1|26302481| BY165835 RIKEN full-length enriched, bon  178   1e-42
EST |BY156223.1|26292869| BY156223 RIKEN full-length enriched, bon  178   1e-42
EST |BY155099.1|26291715| BY155099 RIKEN full-length enriched, bon  178   1e-42
EST |BY076516.1|26178035| BY076516 RIKEN full-length enriched, poo  178   1e-42
EST |BY173137.1|26309783| BY173137 RIKEN full-length enriched, bon  176   4e-42
EST |BY719126.1|27132243| BY719126 RIKEN full-length enriched, adu  174   2e-41
EST |BY082863.1|26193087| BY082863 RIKEN full-length enriched, poo  174   2e-41
EST |CJ089830.1|76190100| CJ089830 RIKEN full-length enriched mous  172   6e-41
EST |BY036169.1|26141612| BY036169 RIKEN full-length enriched, 14   170   3e-40
EST |AA497695.1|2232718| vi68c02.r1 Stratagene mouse testis (#9373  170   3e-40
NR  |BC090072.1|58477428|Rattus norvegicus ubiquitin-conjugating e  170   1e-39
EST |CJ139579.1|76239907| CJ139579 RIKEN full-length enriched mous  167   4e-39
EST |BY272807.1|26463144| BY272807 RIKEN full-length enriched, vis  167   4e-39
EST |BY270776.1|26461113| BY270776 RIKEN full-length enriched, vis  167   4e-39
EST |BY214184.1|26394895| BY214184 RIKEN full-length enriched, act  167   4e-39
EST |BY157829.1|26294475| BY157829 RIKEN full-length enriched, bon  167   4e-39
EST |BY049843.1|26155291| BY049843 RIKEN full-length enriched, poo  167   4e-39
EST |BB867082.1|17113292| BB867082 RIKEN full-length enriched, poo  167   4e-39
EST |BY173172.1|26309818| BY173172 RIKEN full-length enriched, bon  165   2e-38
EST |CB181851.1|28179132| AGENCOURT_11381079 NIH_MGC_164 Mus muscu  163   6e-38
EST |BY259126.1|26440638| BY259126 RIKEN full-length enriched, vis  163   6e-38
EST |BY255691.1|26437203| BY255691 RIKEN full-length enriched, vis  163   6e-38
EST |BY082748.1|26192985| BY082748 RIKEN full-length enriched, poo  163   6e-38
EST |CA490591.1|24953418| AGENCOURT_10814253 NIH_MGC_156 Mus muscu  163   6e-38
EST |BU937229.1|24126048| AGENCOURT_10520326 NIH_MGC_169 Mus muscu  163   6e-38
EST |AI893235.1|5599137| me13d09.y1 Soares mouse embryo NbME13.5 1  163   6e-38
EST |CJ093626.1|76193896| CJ093626 RIKEN full-length enriched mous  159   1e-36
EST |CJ088530.1|76188800| CJ088530 RIKEN full-length enriched mous  159   1e-36
EST |CX222012.1|56877304| MNS37473 Mouse Neurosphere Normalized cD  159   1e-36
EST |CK334916.1|40290529| H3123C03-5 NIA Mouse 15K cDNA Clone Set   159   1e-36
EST |CF733156.1|37629489| UI-M-HB0-cka-n-02-0-UI.r1 NIH_BMAP_HB0 M  159   1e-36
EST |CF164912.1|33274463| B0749E08-5 NIA Mouse Embryonic Germ Cell  159   1e-36
EST |CB526279.1|29359752| UI-M-FY0-cfc-h-23-0-UI.r1 NIH_BMAP_FY0 M  159   1e-36
EST |CA951509.1|27444386| it49f02.y1 Kaestner ngn3 - - Mus musculu  159   1e-36
EST |BY270325.1|26460662| BY270325 RIKEN full-length enriched, vis  159   1e-36
EST |BY257750.1|26439262| BY257750 RIKEN full-length enriched, vis  159   1e-36
EST |BY069892.1|26183672| BY069892 RIKEN full-length enriched, poo  159   1e-36
EST |BY067147.1|26170697| BY067147 RIKEN full-length enriched, 17   159   1e-36
EST |BY061895.1|26166936| BY061895 RIKEN full-length enriched, 17   159   1e-36
EST |BU923101.1|24426963| 7044-30 Mouse E14.5 retina lambda ZAP II  159   1e-36
EST |EL605123.1|126098913| nbf16d10.q1 Mouse lens. Y2H (nbf) Mus m  157   4e-36
EST |BY165778.1|26302424| BY165778 RIKEN full-length enriched, bon  157   4e-36
EST |BQ956303.1|22371781| AGENCOURT_8752899 NIH_MGC_130 Mus muscul  157   4e-36
EST |CX733093.1|58035567| oc39b05.y1 No3 mouse (cataract/retinal d  153   6e-35
EST |CN455501.1|46461227| UI-M-HN0-coi-f-18-0-UI.r1 NIH_BMAP_HN0 M  153   6e-35
EST |BY156182.1|26292828| BY156182 RIKEN full-length enriched, bon  151   2e-34
NM  |NM_080560.2|46048285| Mus musculus ubiquitin-conjugating enzy  149   5e-35
EST |CX220507.1|56875799| MNS36183 Mouse Neurosphere Normalized cD  149   9e-34
EST |CF733055.1|37629388| UI-M-HB0-cka-j-17-0-UI.r1 NIH_BMAP_HB0 M  149   9e-34
EST |CA530025.1|25044091| 9024-18 Mouse E14.5 retina lambda ZAP II  149   9e-34
EST |BQ568431.1|21471748| gi108b06.y1 Mouse Organ of Corti cDNA pB  149   9e-34
EST |BQ567742.1|21471059| gi95f12.y1 Mouse Organ of Corti cDNA pBl  149   9e-34
EST |BF607028.1|13503520| MY2_000148 Mouse 9-day fetus cDNA librar  149   9e-34
NR  |BC067069.1|45219884|Mus musculus ubiquitin-conjugating enzyme  149   4e-33
EST |CJ135371.1|76235699| CJ135371 RIKEN full-length enriched mous  147   4e-33
EST |CK620351.1|41341237| ml11b07.y1 Mouse retina, unamplified: mk  147   4e-33
EST |BY158307.1|26294953| BY158307 RIKEN full-length enriched, bon  147   4e-33
EST |W65672.1|1373888| me13d09.r1 Soares mouse embryo NbME13.5 14.  147   4e-33
EST |AV507667.1|140609904| AV507667 Abe mouse ES cell Mus musculus  145   1e-32
EST |CV562835.1|54453924| UI-M-HL0-ctt-l-05-0-UI.r1 NIH_BMAP_HL0 M  145   1e-32
NM  |XM_885442.2|94380513| PREDICTED: Mus musculus similar to ubiq  143   3e-33
NM  |XM_905142.2|94380497| PREDICTED: Mus musculus similar to ubiq  143   3e-33
NM  |XM_973165.1|94382300| PREDICTED: Mus musculus similar to ubiq  143   3e-33
NT  |NT_039428.6|94380591|Mus musculus chromosome 7 genomic contig  143   7e-32
NR  |AC119249.7|58000577|Mus musculus chromosome 7, clone RP24-274  143   3e-31
NR  |AC151472.2|62526269|Mus musculus BAC clone RP23-407N2 from ch  143   3e-31
EST |BU512034.1|22818267| AGENCOURT_10115731 NIH_MGC_134 Mus muscu  141   2e-31
NM  |NM_003348.3|37577134| Homo sapiens ubiquitin-conjugating enzy  139   4e-32
EST |CJ149568.1|76249941| CJ149568 RIKEN full-length enriched mous  139   9e-31
EST |BQ749025.1|21895812| UI-M-FB0-bxy-j-08-0-UI.r1 NIH_BMAP_FB0 M  139   9e-31
NR  |AC025260.29|23306054|Homo sapiens 12 BAC RP11-356O22 (Roswell  139   4e-30
NR  |BC000396.2|33875387|Homo sapiens ubiquitin-conjugating enzyme  139   4e-30
NR  |AB169913.1|67971303|Macaca fascicularis brain cDNA, clone: Qt  139   4e-30
EST |BQ899535.1|22291549| AGENCOURT_8749030 NIH_MGC_130 Mus muscul  137   4e-30
EST |D77762.1|1597558| MUSB8D06 mouse embryonal carcinoma cell lin  137   4e-30
EST |AV454796.1|140556151| AV454796 Abe mouse ES cell Mus musculus  133   5e-29
EST |BU938063.1|24126882| AGENCOURT_10521280 NIH_MGC_169 Mus muscu  133   5e-29
EST |BU604552.1|23256311| AGENCOURT_10050112 NIH_MGC_144 Mus muscu  133   5e-29
EST |CX565418.1|57592447| UI-M-HA0-cuk-b-03-0-UI.r1 NIH_BMAP_HA0 M  131   2e-28
EST |BY124529.1|26235630| BY124529 RIKEN full-length enriched, adu  127   3e-27
NT  |NT_109320.3|94375121|Mus musculus chromosome 5 genomic contig  127   4e-27
NR  |AC124468.3|40949622|Mus musculus BAC clone RP24-165F16 from c  127   2e-26
NR  |AY039837.1|15020281|Mus musculus E2 ubiquitin conjugating enz  127   2e-26
NR  |AF146793.2|7684609|Mus musculus Neuromedin U precursor (Nmu)   127   2e-26
NR  |AC147239.2|48675523|Mus musculus BAC clone RP23-386C10 from c  127   2e-26
EST |BY206848.1|26386764| BY206848 RIKEN full-length enriched, B6-  125   1e-26
EST |AA271547.1|1909910| vb74e11.r1 Soares mouse 3NME12 5 Mus musc  125   1e-26
EST |CX240779.1|56896071| NMA03569 Mus Musculus Lateral Ventricle   123   5e-26
EST |BQ930129.1|22345160| AGENCOURT_8952698 NCI_CGAP_Co24 Mus musc  121   2e-25
NR  |BC108704.1|80479361|Homo sapiens ubiquitin-conjugating enzyme  121   1e-24
EST |D28664.1|618981| MUS88D03 mouse embryonal carcinoma cell line  119   8e-25
NR  |AC024451.8|21637522|Homo sapiens chromosome 11, clone RP11-69  119   4e-24
EST |AV463514.1|140590465| AV463514 Abe mouse ES cell Mus musculus  113   5e-23
EST |CJ135631.1|76235959| CJ135631 RIKEN full-length enriched mous  113   5e-23
EST |BI685075.1|15647703| 603310060F1 NCI_CGAP_Mam6 Mus musculus c  113   5e-23
EST |BG873447.1|14223987| 602791062F1 NCI_CGAP_SG2 Mus musculus cD  113   5e-23
EST |CN457491.1|46463217| UI-M-HP0-cok-l-04-0-UI.r1 NIH_BMAP_HP0 M  111   2e-22
EST |CA880981.1|27332530| K0987B06-5N NIA Mouse Neural Stem Cell (  111   2e-22
EST |BI733686.1|15710699| 603354887F1 NIH_MGC_94 Mus musculus cDNA  111   2e-22
NR  |AC148448.3|73912751|Pan troglodytes chromosome X clone PTB-00  111   9e-22
EST |BY032917.1|26138360| BY032917 RIKEN full-length enriched, 13   109   8e-22
EST |BM936779.1|19395931| UI-M-CG0p-bqc-a-02-0-UI.r1 NIH_BMAP_Ret4  109   8e-22
EST |DV047773.1|76375056| DAY20_19_B06.x1 FH DAY20 Mus musculus cD  107   3e-21
EST |BY775803.1|39702441| BY775803 RIKEN full-length enriched, 17.  107   3e-21
EST |BG294478.1|13055152| 602391595F1 NIH_MGC_94 Mus musculus cDNA  107   3e-21
EST |BB577941.1|11474485| BB577941 RIKEN full-length enriched, adu  107   3e-21
EST |DV049827.1|76377110| DAY35S_07_A21.x1 FH DAY35S Mus musculus   105   1e-20
EST |DV045140.1|76372404| DAY20_08_B15.x1 FH DAY20 Mus musculus cD  105   1e-20
EST |CK333557.1|40233229| H8249D10-5 NIA Mouse Unique Gene Set Ver  103   5e-20
EST |CA542229.1|25084793| C0616D06-5N NIA Mouse Trophoblast Stem C  103   5e-20
NR  |BC034898.1|22028189|Mus musculus ubiquitin-conjugating enzyme  103   2e-19
NR  |BC003365.1|13097194|Homo sapiens ubiquitin-conjugating enzyme  103   2e-19
NR  |BC119931.1|112362018|Bos taurus similar to ubiquitin-conjugat  103   2e-19
EST |BG294616.1|13055426| 602391957F1 NIH_MGC_94 Mus musculus cDNA  101   2e-19
EST |AL034974.1|6646600| r8710a05 Beddington mouse dissected endod  101   2e-19
NR  |AC188064.1|109715949|Callithrix jacchus chromosome UNK clone   101   9e-19
NR  |BC132630.1|124376821|Mus musculus ubiquitin-conjugating enzym  100   4e-18
EST |CX222629.1|56877921| MNS39283 Mouse Neurosphere Normalized cD   98   3e-18
EST |CD355277.1|31147778| UI-M-FY0-cgl-n-09-0-UI.r1 NIH_BMAP_FY0 M   98   3e-18
EST |AA982879.1|3161538| ub59h08.r1 Soares_mammary_gland_NMLMG Mus   98   3e-18
EST |DV067921.1|76395219| UGS01_13_I23.x1 FH UGS01 Mus musculus cD   96   1e-17
EST |CJ068843.1|76151132| CJ068843 RIKEN full-length enriched mous   96   1e-17
EST |CF731656.1|37627986| UI-M-HA0-cjv-e-17-0-UI.r1 NIH_BMAP_HA0 M   92   2e-16
EST |AV498533.1|140548082| AV498533 Abe mouse ES cell Mus musculus   90   7e-16
EST |CF952004.1|38467873| UI-M-HL0-cnc-l-24-0-UI.r1 NIH_BMAP_HL0 M   90   7e-16
EST |AV448575.1|140493373| AV448575 Abe mouse ES cell Mus musculus   88   3e-15
EST |CD352707.1|31145208| UI-M-GL0-cfy-b-24-0-UI.r1 NIH_BMAP_GL0 M   88   3e-15
EST |BU510933.1|22817166| AGENCOURT_10120051 NIH_MGC_134 Mus muscu   88   3e-15
EST |BQ922699.1|22337730| AGENCOURT_8909160 NCI_CGAP_Mam2 Mus musc   88   3e-15
NT  |NT_039589.6|94395369|Mus musculus chromosome 13 genomic conti   86   1e-14
EST |AV478484.1|140602411| AV478484 Abe mouse ES cell Mus musculus   86   1e-14
EST |CF732951.1|37629284| UI-M-HB0-cka-g-10-0-UI.r1 NIH_BMAP_HB0 M   86   1e-14
EST |BU056811.1|22496888| UI-M-FO0-bzz-h-05-0-UI.r1 NIH_BMAP_FO0 M   86   1e-14
EST |BI735526.1|15712539| 603357635F1 NIH_MGC_94 Mus musculus cDNA   86   1e-14
NR  |CT025645.16|87080626|Mouse DNA sequence from clone RP23-233D2   86   5e-14
NR  |AE000658.1|2358019|Homo sapiens T-cell receptor alpha delta l   86   5e-14
EST |AV578948.1|141300168| AV578948 Abe mouse ES cell Mus musculus   84   5e-14
EST |CA451740.1|24816160| UI-M-FX0-ccj-h-23-0-UI.r1 NIH_BMAP_FX0 M   82   2e-13
EST |BY099029.1|26209646| BY099029 RIKEN full-length enriched, adu   80   7e-13
EST |BY098096.1|26208713| BY098096 RIKEN full-length enriched, adu   80   7e-13
EST |BY077516.1|26178964| BY077516 RIKEN full-length enriched, adu   80   7e-13
EST |BI151478.1|14611479| 602917488F1 NCI_CGAP_Lu29 Mus musculus c   80   7e-13
EST |CF534771.1|34586739| UI-M-GH0-cgx-c-03-0-UI.r1 NIH_BMAP_GH0 M   78   3e-12
NR  |AC146920.3|66773529|Otolemur garnettii clone CH256-154N14, co   78   1e-11
EST |AA832626.1|2906354| vw43h11.r1 Soares_mammary_gland_NbMMG Mus   76   1e-11
EST |CN456076.1|46461802| UI-M-HN0-coh-a-20-0-UI.r1 NIH_BMAP_HN0 M   72   2e-10
EST |CA529497.1|25043563| 9011-47 Mouse E14.5 retina lambda ZAP II   70   7e-10
EST |BG519383.1|13514991| 602577646F1 NCI_CGAP_Mam6 Mus musculus c   68   3e-09
EST |CN705719.1|47474468| E0506A05-5 NIA Mouse eight-cell-Embryo c   66   1e-08
EST |BI739032.1|15716058| 603359882F1 NIH_MGC_94 Mus musculus cDNA   64   4e-08
EST |DV074077.1|76401375| VP01_18_M22.x1 FH VP01 Mus musculus cDNA   62   2e-07
NM  |XM_989201.1|94409278| PREDICTED: Mus musculus similar to ubiq   56   6e-07
NM  |XM_621074.3|94408111| PREDICTED: Mus musculus similar to ubiq   56   6e-07
NM  |XM_910030.2|94408073| PREDICTED: Mus musculus similar to ubiq   56   6e-07






















[ summary ]

>|AV470352.1|140489389| AV470352 Abe mouse ES cell Mus musculus cDNA
           clone 19990924EK02B10, mRNA sequence
          Length = 295

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 11  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 70

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 71  acaagatggccgggctgccccgcaggatcatcaa 104
























[ summary ]

>|EL604700.1|126098431| nbf06c11.q1 Mouse lens. Y2H (nbf) Mus
           musculus cDNA clone nbf06c11, mRNA sequence
          Length = 120

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 65

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 66  acaagatggccgggctgccccgcaggatcatcaa 99
























[ summary ]

>|CJ170466.1|76299202| CJ170466 RIKEN full-length enriched mouse
           cDNA library, Rathke's pouches 14.5 days embryo Mus
           musculus cDNA clone M130031E14 5', mRNA sequence
          Length = 405

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 63

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 64  acaagatggccgggctgccccgcaggatcatcaa 97
























[ summary ]

>|CJ167790.1|76278277| CJ167790 RIKEN full-length enriched mouse
           cDNA library, Rathke's pouches 14.5 days embryo Mus
           musculus cDNA clone M130021E10 5', mRNA sequence
          Length = 441

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 63

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 64  acaagatggccgggctgccccgcaggatcatcaa 97
























[ summary ]

>|CJ130896.1|76231224| CJ130896 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J melanocyte Mus musculus cDNA
           clone G270063M20 5', mRNA sequence
          Length = 460

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 69

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 70  acaagatggccgggctgccccgcaggatcatcaa 103
























[ summary ]

>|DN175640.1|60270887| NMB05557 Mus Musculus Lateral Ventricle Wall
           C57BL/6 adult Mus musculus cDNA 5', mRNA sequence
          Length = 610

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 68

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 69  acaagatggccgggctgccccgcaggatcatcaa 102
























[ summary ]

>|BY773936.1|39700574| BY773936 RIKEN full-length enriched, 17.5
           days embryo whole body Mus musculus cDNA clone
           L930079B05 5', mRNA sequence
          Length = 347

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 67

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 68  acaagatggccgggctgccccgcaggatcatcaa 101
























[ summary ]

>|CB951897.1|30207570| AGENCOURT_13597065 NIH_MGC_178 Mus musculus
           cDNA clone IMAGE:30301290 5', mRNA sequence
          Length = 752

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 17  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 76

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 77  acaagatggccgggctgccccgcaggatcatcaa 110
























[ summary ]

>|BY287775.1|26478112| BY287775 RIKEN full-length enriched, visual
           cortex Mus musculus cDNA clone K530042I03 5', mRNA
           sequence
          Length = 432

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 68

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 69  acaagatggccgggctgccccgcaggatcatcaa 102
























[ summary ]

>|BY163260.1|26299906| BY163260 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830044K08 5',
           mRNA sequence
          Length = 375

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 68

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 69  acaagatggccgggctgccccgcaggatcatcaa 102
























[ summary ]

>|BY162108.1|26298754| BY162108 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830037I03 5',
           mRNA sequence
          Length = 360

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 62

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 63  acaagatggccgggctgccccgcaggatcatcaa 96
























[ summary ]

>|BY161114.1|26297760| BY161114 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830031O20 5',
           mRNA sequence
          Length = 366

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 66

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 67  acaagatggccgggctgccccgcaggatcatcaa 100
























[ summary ]

>|BY100131.1|26210748| BY100131 RIKEN full-length enriched, pooled
           tissues, adult spleen, etc. Mus musculus cDNA clone
           K630130J20 5', mRNA sequence
          Length = 406

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 324

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 325 acaagatggccgggctgccccgcaggatcatcaa 358
























[ summary ]

>|BY089715.1|26199059| BY089715 RIKEN full-length enriched, pooled
           tissues, adult spleen, etc. Mus musculus cDNA clone
           K630076P22 5', mRNA sequence
          Length = 384

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 81

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 82  acaagatggccgggctgccccgcaggatcatcaa 115
























[ summary ]

>|BY067781.1|26171222| BY067781 RIKEN full-length enriched, 13 days
           embryo liver Mus musculus cDNA clone I920056J18 5', mRNA
           sequence
          Length = 326

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 67

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 68  acaagatggccgggctgccccgcaggatcatcaa 101
























[ summary ]

>|BY054940.1|26160388| BY054940 RIKEN full-length enriched, pooled
           tissues, cell_line=TIB-55BB88, etc. Mus musculus cDNA
           clone I730080G09 5', mRNA sequence
          Length = 376

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 62

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 63  acaagatggccgggctgccccgcaggatcatcaa 96
























[ summary ]

>|BY036764.1|26142207| BY036764 RIKEN full-length enriched, pooled
           tissues, 14 days embryo, etc. Mus musculus cDNA clone
           I530026M03 5', mRNA sequence
          Length = 375

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 81

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 82  acaagatggccgggctgccccgcaggatcatcaa 115
























[ summary ]

>|CA466104.1|24922456| AGENCOURT_10723593 NIH_MGC_169 Mus musculus
           cDNA clone IMAGE:6774421 5', mRNA sequence
          Length = 837

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 266 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 325

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 326 acaagatggccgggctgccccgcaggatcatcaa 359
























[ summary ]

>|BU961568.1|24191140| AGENCOURT_10613948 NIH_MGC_169 Mus musculus
           cDNA clone IMAGE:6742174 5', mRNA sequence
          Length = 815

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 326

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 327 acaagatggccgggctgccccgcaggatcatcaa 360
























[ summary ]

>|BU702179.1|23626725| UI-M-FI0-byr-a-05-0-UI.r1 NIH_BMAP_FI0 Mus
           musculus cDNA clone IMAGE:5698060 5', mRNA sequence
          Length = 749

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 69

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 70  acaagatggccgggctgccccgcaggatcatcaa 103
























[ summary ]

>|BQ895462.1|22287476| AGENCOURT_8751324 NIH_MGC_130 Mus musculus
           cDNA clone IMAGE:6333763 5', mRNA sequence
          Length = 911

 Score =  186 bits (94), Expect = 4e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 88

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 89  acaagatggccgggctgccccgcaggatcatcaa 122
























[ summary ]

>|NT_039500.6|94388742|Mus musculus chromosome 10 genomic contig, strain
                C57BL/6J
          Length = 56301133

 Score =  186 bits (94), Expect = 5e-45
 Identities = 94/94 (100%)
 Strand = Plus / Plus

                                                                            
Query: 148      ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21286816 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 21286875

                                                  
Query: 208      acaagatggccgggctgccccgcaggatcatcaa 241
                ||||||||||||||||||||||||||||||||||
Sbjct: 21286876 acaagatggccgggctgccccgcaggatcatcaa 21286909
























[ summary ]

>|CD541021.1|31588756| B0227G05-5 NIA Mouse Embryonic Germ Cell cDNA
           Library (Long) Mus musculus cDNA clone NIA:B0227G05
           IMAGE:30106060 5', mRNA sequence
          Length = 331

 Score =  180 bits (91), Expect = 3e-43
 Identities = 91/91 (100%)
 Strand = Plus / Plus

                                                                       
Query: 151 ctcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgaca 210
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ctcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgaca 60

                                          
Query: 211 agatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||
Sbjct: 61  agatggccgggctgccccgcaggatcatcaa 91
























[ summary ]

>|BY309065.1|26499402| BY309065 RIKEN full-length enriched, stroma
           cell Mus musculus cDNA clone I320008C23 5', mRNA
           sequence
          Length = 373

 Score =  180 bits (91), Expect = 3e-43
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 48  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 107

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||| ||||||||||||||||||||||||
Sbjct: 108 acaagatggncgggctgccccgcaggatcatcaa 141
























[ summary ]

>|AV490497.1|140539800| AV490497 Abe mouse ES cell Mus musculus cDNA
           clone 19991116EK03E04, mRNA sequence
          Length = 502

 Score =  178 bits (90), Expect = 1e-42
 Identities = 90/90 (100%)
 Strand = Plus / Plus

                                                                       
Query: 152 tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 211
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 60

                                         
Query: 212 gatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||
Sbjct: 61  gatggccgggctgccccgcaggatcatcaa 90
























[ summary ]

>|CJ162632.1|76273119| CJ162632 RIKEN full-length enriched mouse
           cDNA library, Rathke's pouches 14.5 days embryo Mus
           musculus cDNA clone M130004A10 5', mRNA sequence
          Length = 485

 Score =  178 bits (90), Expect = 1e-42
 Identities = 90/90 (100%)
 Strand = Plus / Plus

                                                                       
Query: 152 tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 211
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 60

                                         
Query: 212 gatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||
Sbjct: 61  gatggccgggctgccccgcaggatcatcaa 90
























[ summary ]

>|CN695529.1|47464278| E0366C12-5 NIA Mouse E10.5 whole embryo cDNA
           library (Long) Mus musculus cDNA clone NIA:E0366C12
           IMAGE:30865283 5', mRNA sequence
          Length = 114

 Score =  178 bits (90), Expect = 1e-42
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12  ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 71

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||| |||||||||
Sbjct: 72  acaagatggccgggctgccccgcacgatcatcaa 105
























[ summary ]

>|BY168490.1|26305136| BY168490 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830071P16 5',
           mRNA sequence
          Length = 355

 Score =  178 bits (90), Expect = 1e-42
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 3   ccactcgagcgtgaggagagcggagccggagacaagagccgaggccgaactcgggatctg 62

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 63  acaagatggccgggctgccccgcaggatcatcaa 96
























[ summary ]

>|BY165835.1|26302481| BY165835 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830058M11 5',
           mRNA sequence
          Length = 384

 Score =  178 bits (90), Expect = 1e-42
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 7   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgacctcgggatctg 66

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 67  acaagatggccgggctgccccgcaggatcatcaa 100
























[ summary ]

>|BY156223.1|26292869| BY156223 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830007C10 5',
           mRNA sequence
          Length = 397

 Score =  178 bits (90), Expect = 1e-42
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 68

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||| |||||||||||
Sbjct: 69  acaagatggccgggctgccccggaggatcatcaa 102
























[ summary ]

>|BY155099.1|26291715| BY155099 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830002B07 5',
           mRNA sequence
          Length = 409

 Score =  178 bits (90), Expect = 1e-42
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 68

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||| |||||||||||
Sbjct: 69  acaagatggccgggctgccccgaaggatcatcaa 102
























[ summary ]

>|BY076516.1|26178035| BY076516 RIKEN full-length enriched, pooled
           tissues, adult spleen, etc. Mus musculus cDNA clone
           K630004L02 5', mRNA sequence
          Length = 386

 Score =  178 bits (90), Expect = 1e-42
 Identities = 90/90 (100%)
 Strand = Plus / Plus

                                                                       
Query: 152 tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 211
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 60

                                         
Query: 212 gatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||
Sbjct: 61  gatggccgggctgccccgcaggatcatcaa 90
























[ summary ]

>|BY173137.1|26309783| BY173137 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830096G20 5',
           mRNA sequence
          Length = 367

 Score =  176 bits (89), Expect = 4e-42
 Identities = 92/93 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 9   ccactcgagcgtgaggagagcggcgccggagacaagagcagaggccgaactcgggatctg 68

                                            
Query: 208 acaagatggccgggctgccccgcaggatcatca 240
           |||||||||||||||||||||||||||||||||
Sbjct: 69  acaagatggccgggctgccccgcaggatcatca 101
























[ summary ]

>|BY719126.1|27132243| BY719126 RIKEN full-length enriched, adult
           male olfactory brain Mus musculus cDNA clone 6430590I02
           5', mRNA sequence
          Length = 698

 Score =  174 bits (88), Expect = 2e-41
 Identities = 88/88 (100%)
 Strand = Plus / Plus

                                                                       
Query: 154 gagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaaga 213
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaaga 60

                                       
Query: 214 tggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||
Sbjct: 61  tggccgggctgccccgcaggatcatcaa 88
























[ summary ]

>|BY082863.1|26193087| BY082863 RIKEN full-length enriched, pooled
           tissues, adult spleen, etc. Mus musculus cDNA clone
           K630040C12 5', mRNA sequence
          Length = 373

 Score =  174 bits (88), Expect = 2e-41
 Identities = 88/88 (100%)
 Strand = Plus / Plus

                                                                       
Query: 154 gagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaaga 213
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaaga 60

                                       
Query: 214 tggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||
Sbjct: 61  tggccgggctgccccgcaggatcatcaa 88
























[ summary ]

>|CJ089830.1|76190100| CJ089830 RIKEN full-length enriched mouse
           cDNA library, pooled tissue 6 Mus musculus cDNA clone
           I530028D07 5', mRNA sequence
          Length = 374

 Score =  172 bits (87), Expect = 6e-41
 Identities = 89/90 (98%)
 Strand = Plus / Plus

                                                                       
Query: 152 tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 211
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 60

                                         
Query: 212 gatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||| |||||
Sbjct: 61  gatggccgggctgccccgcaggatnatcaa 90
























[ summary ]

>|BY036169.1|26141612| BY036169 RIKEN full-length enriched, 14 days
           pregnant adult female placenta Mus musculus cDNA clone
           I530022O19 5', mRNA sequence
          Length = 371

 Score =  170 bits (86), Expect = 3e-40
 Identities = 86/86 (100%)
 Strand = Plus / Plus

                                                                       
Query: 156 gcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatg 215
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   gcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatg 62

                                     
Query: 216 gccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||
Sbjct: 63  gccgggctgccccgcaggatcatcaa 88
























[ summary ]

>|AA497695.1|2232718| vi68c02.r1 Stratagene mouse testis (#937308)
           Mus musculus cDNA clone IMAGE:917378 5' similar to
           TR:G1181558 G1181558 UBIQUITIN-CONJUGATING ENZYME E2 ;,
           mRNA sequence
          Length = 461

 Score =  170 bits (86), Expect = 3e-40
 Identities = 92/94 (97%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||
Sbjct: 130 ccactcgagcgtgaggagagcggaccgggagacaagagcagaggccgaactcgggatctg 189

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 190 acaagatggccgggctgccccgcaggatcatcaa 223
























[ summary ]

>|BC090072.1|58477428|Rattus norvegicus ubiquitin-conjugating enzyme
           E2N, mRNA (cDNA clone MGC:93937 IMAGE:7113593), complete
           cds.
          Length = 1575

 Score =  170 bits (86), Expect = 1e-39
 Identities = 92/94 (97%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 ccactcgtgcgtgaggcgagcggagccggagacaagagcagaggccgaactcgggatctg 334

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 335 acaagatggccgggctgccccgcaggatcatcaa 368
























[ summary ]

>|CJ139579.1|76239907| CJ139579 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J B6-derived CD11 +ve dendritic
           cells Mus musculus cDNA clone F730203P15 5', mRNA
           sequence
          Length = 484

 Score =  167 bits (84), Expect = 4e-39
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 61

                                   
Query: 218 cgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatcaa 85
























[ summary ]

>|BY272807.1|26463144| BY272807 RIKEN full-length enriched, visual
           cortex Mus musculus cDNA clone K430055C11 5', mRNA
           sequence
          Length = 408

 Score =  167 bits (84), Expect = 4e-39
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 61

                                   
Query: 218 cgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatcaa 85
























[ summary ]

>|BY270776.1|26461113| BY270776 RIKEN full-length enriched, visual
           cortex Mus musculus cDNA clone K430041P20 5', mRNA
           sequence
          Length = 433

 Score =  167 bits (84), Expect = 4e-39
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 61

                                   
Query: 218 cgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatcaa 85
























[ summary ]

>|BY214184.1|26394895| BY214184 RIKEN full-length enriched,
           activated spleen Mus musculus cDNA clone F830027L10 5',
           mRNA sequence
          Length = 354

 Score =  167 bits (84), Expect = 4e-39
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 61

                                   
Query: 218 cgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatcaa 85
























[ summary ]

>|BY157829.1|26294475| BY157829 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830014M14 5',
           mRNA sequence
          Length = 409

 Score =  167 bits (84), Expect = 4e-39
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 61

                                   
Query: 218 cgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatcaa 85
























[ summary ]

>|BY049843.1|26155291| BY049843 RIKEN full-length enriched, pooled
           tissues, cell_line=TIB-55BB88, etc. Mus musculus cDNA
           clone I730057O09 5', mRNA sequence
          Length = 416

 Score =  167 bits (84), Expect = 4e-39
 Identities = 87/88 (98%)
 Strand = Plus / Plus

                                                                       
Query: 154 gagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaaga 213
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 2   gagcgtgaggagagcggagccggacacaagagcagaggccgaactcgggatctgacaaga 61

                                       
Query: 214 tggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||
Sbjct: 62  tggccgggctgccccgcaggatcatcaa 89
























[ summary ]

>|BB867082.1|17113292| BB867082 RIKEN full-length enriched, pooled
           cell lines, RCB-0544,etc. Mus musculus cDNA clone
           G4D0005I16 5', mRNA sequence
          Length = 482

 Score =  167 bits (84), Expect = 4e-39
 Identities = 90/92 (97%)
 Strand = Plus / Plus

                                                                       
Query: 150 actcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgac 209
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 11  actcgagcgtgaggagagcggagccggagacaagagcagaggccgaacttgggatctgac 70

                                           
Query: 210 aagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||| ||||||||||||||||
Sbjct: 71  aagatggccgggctggcccgcaggatcatcaa 102
























[ summary ]

>|BY173172.1|26309818| BY173172 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830096J11 5',
           mRNA sequence
          Length = 369

 Score =  165 bits (83), Expect = 2e-38
 Identities = 83/83 (100%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 61

                                  
Query: 218 cgggctgccccgcaggatcatca 240
           |||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatca 84
























[ summary ]

>|CB181851.1|28179132| AGENCOURT_11381079 NIH_MGC_164 Mus musculus
           cDNA clone IMAGE:30241805 5', mRNA sequence
          Length = 951

 Score =  163 bits (82), Expect = 6e-38
 Identities = 85/86 (98%)
 Strand = Plus / Plus

                                                                       
Query: 156 gcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatg 215
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatg 60

                                     
Query: 216 gccgggctgccccgcaggatcatcaa 241
           |||||||||||||||| |||||||||
Sbjct: 61  gccgggctgccccgcaagatcatcaa 86
























[ summary ]

>|BY259126.1|26440638| BY259126 RIKEN full-length enriched, visual
           cortex Mus musculus cDNA clone K330043F24 5', mRNA
           sequence
          Length = 450

 Score =  163 bits (82), Expect = 6e-38
 Identities = 82/82 (100%)
 Strand = Plus / Plus

                                                                       
Query: 160 gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 61

                                 
Query: 220 ggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||
Sbjct: 62  ggctgccccgcaggatcatcaa 83
























[ summary ]

>|BY255691.1|26437203| BY255691 RIKEN full-length enriched, visual
           cortex Mus musculus cDNA clone K330020A19 5', mRNA
           sequence
          Length = 498

 Score =  163 bits (82), Expect = 6e-38
 Identities = 82/82 (100%)
 Strand = Plus / Plus

                                                                       
Query: 160 gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 61

                                 
Query: 220 ggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||
Sbjct: 62  ggctgccccgcaggatcatcaa 83
























[ summary ]

>|BY082748.1|26192985| BY082748 RIKEN full-length enriched, pooled
           tissues, adult spleen, etc. Mus musculus cDNA clone
           K630039K02 5', mRNA sequence
          Length = 368

 Score =  163 bits (82), Expect = 6e-38
 Identities = 82/82 (100%)
 Strand = Plus / Plus

                                                                       
Query: 160 gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 62

                                 
Query: 220 ggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||
Sbjct: 63  ggctgccccgcaggatcatcaa 84
























[ summary ]

>|CA490591.1|24953418| AGENCOURT_10814253 NIH_MGC_156 Mus musculus
           cDNA clone IMAGE:6758821 5', mRNA sequence
          Length = 812

 Score =  163 bits (82), Expect = 6e-38
 Identities = 82/82 (100%)
 Strand = Plus / Plus

                                                                       
Query: 160 gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38  gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 97

                                 
Query: 220 ggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||
Sbjct: 98  ggctgccccgcaggatcatcaa 119
























[ summary ]

>|BU937229.1|24126048| AGENCOURT_10520326 NIH_MGC_169 Mus musculus
           cDNA clone IMAGE:6705087 5', mRNA sequence
          Length = 902

 Score =  163 bits (82), Expect = 6e-38
 Identities = 82/82 (100%)
 Strand = Plus / Plus

                                                                       
Query: 160 gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4   gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 63

                                 
Query: 220 ggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||
Sbjct: 64  ggctgccccgcaggatcatcaa 85
























[ summary ]

>|AI893235.1|5599137| me13d09.y1 Soares mouse embryo NbME13.5 14.5
           Mus musculus cDNA clone IMAGE:387377 5' similar to
           SW:UBCC_HUMAN Q16781 UBIQUITIN-CONJUGATING ENZYME E2-17
           KD ;, mRNA sequence
          Length = 625

 Score =  163 bits (82), Expect = 6e-38
 Identities = 91/94 (96%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 105 ccactctagcgtgaggagagcggatccggagacaagagcagaggccgaactcgggatctg 164

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||| ||||||||||||||||
Sbjct: 165 acaagatggccgggctgtcccgcaggatcatcaa 198
























[ summary ]

>|CJ093626.1|76193896| CJ093626 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J heart 17 days embryo Mus musculus
           cDNA clone I920110B07 5', mRNA sequence
          Length = 448

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 65

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 66  ctgccccgcaggatcatcaa 85
























[ summary ]

>|CJ088530.1|76188800| CJ088530 RIKEN full-length enriched mouse
           cDNA library, pooled tissue 5 Mus musculus cDNA clone
           I030102B15 5', mRNA sequence
          Length = 417

 Score =  159 bits (80), Expect = 1e-36
 Identities = 86/88 (97%)
 Strand = Plus / Plus

                                                                       
Query: 154 gagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaaga 213
           |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 3   gagcgtgaggagagcggagccggacacaacagcagaggccgaactcgggatctgacaaga 62

                                       
Query: 214 tggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||
Sbjct: 63  tggccgggctgccccgcaggatcatcaa 90
























[ summary ]

>|CX222012.1|56877304| MNS37473 Mouse Neurosphere Normalized cDNA
           library Mus musculus cDNA 5', mRNA sequence
          Length = 700

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 60

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 61  ctgccccgcaggatcatcaa 80
























[ summary ]

>|CK334916.1|40290529| H3123C03-5 NIA Mouse 15K cDNA Clone Set Mus
           musculus cDNA clone H3123C03 5', mRNA sequence
          Length = 160

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 60

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 61  ctgccccgcaggatcatcaa 80
























[ summary ]

>|CF733156.1|37629489| UI-M-HB0-cka-n-02-0-UI.r1 NIH_BMAP_HB0 Mus
           musculus cDNA clone IMAGE:30550105 5', mRNA sequence
          Length = 767

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 60

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 61  ctgccccgcaggatcatcaa 80
























[ summary ]

>|CF164912.1|33274463| B0749E08-5 NIA Mouse Embryonic Germ Cell cDNA
           Library (Long) Mus musculus cDNA clone NIA:B0749E08
           IMAGE:30462583 5', mRNA sequence
          Length = 550

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 60

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 61  ctgccccgcaggatcatcaa 80
























[ summary ]

>|CB526279.1|29359752| UI-M-FY0-cfc-h-23-0-UI.r1 NIH_BMAP_FY0 Mus
           musculus cDNA clone IMAGE:6847656 5', mRNA sequence
          Length = 725

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 60

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 61  ctgccccgcaggatcatcaa 80
























[ summary ]

>|CA951509.1|27444386| it49f02.y1 Kaestner ngn3 - - Mus musculus
           cDNA clone IMAGE: 5', mRNA sequence
          Length = 115

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29  ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 88

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 89  ctgccccgcaggatcatcaa 108
























[ summary ]

>|BY270325.1|26460662| BY270325 RIKEN full-length enriched, visual
           cortex Mus musculus cDNA clone K430039J01 5', mRNA
           sequence
          Length = 415

 Score =  159 bits (80), Expect = 1e-36
 Identities = 83/84 (98%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagagggcgaactcgggatctgacaagatggc 61

                                   
Query: 218 cgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatcaa 85
























[ summary ]

>|BY257750.1|26439262| BY257750 RIKEN full-length enriched, visual
           cortex Mus musculus cDNA clone K330031K07 5', mRNA
           sequence
          Length = 516

 Score =  159 bits (80), Expect = 1e-36
 Identities = 83/84 (98%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 217
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gtgatgagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggc 61

                                   
Query: 218 cgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||
Sbjct: 62  cgggctgccccgcaggatcatcaa 85
























[ summary ]

>|BY069892.1|26183672| BY069892 RIKEN full-length enriched, pooled
           tissues, 16 days embryo, etc. Mus musculus cDNA clone
           I920069M03 5', mRNA sequence
          Length = 394

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 65

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 66  ctgccccgcaggatcatcaa 85
























[ summary ]

>|BY067147.1|26170697| BY067147 RIKEN full-length enriched, 17 days
           embryo heart Mus musculus cDNA clone I920052O07 5', mRNA
           sequence
          Length = 376

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 65

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 66  ctgccccgcaggatcatcaa 85
























[ summary ]

>|BY061895.1|26166936| BY061895 RIKEN full-length enriched, 17 days
           embryo heart Mus musculus cDNA clone I920019M23 5', mRNA
           sequence
          Length = 314

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 65

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 66  ctgccccgcaggatcatcaa 85
























[ summary ]

>|BU923101.1|24426963| 7044-30 Mouse E14.5 retina lambda ZAP II
           Library Mus musculus cDNA, mRNA sequence
          Length = 600

 Score =  159 bits (80), Expect = 1e-36
 Identities = 80/80 (100%)
 Strand = Plus / Plus

                                                                       
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 221
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccggg 60

                               
Query: 222 ctgccccgcaggatcatcaa 241
           ||||||||||||||||||||
Sbjct: 61  ctgccccgcaggatcatcaa 80
























[ summary ]

>|EL605123.1|126098913| nbf16d10.q1 Mouse lens. Y2H (nbf) Mus
           musculus cDNA clone nbf16d10, mRNA sequence
          Length = 88

 Score =  157 bits (79), Expect = 4e-36
 Identities = 82/83 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 6   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgagatctg 65

                                  
Query: 208 acaagatggccgggctgccccgc 230
           |||||||||||||||||||||||
Sbjct: 66  acaagatggccgggctgccccgc 88
























[ summary ]

>|BY165778.1|26302424| BY165778 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830058I09 5',
           mRNA sequence
          Length = 386

 Score =  157 bits (79), Expect = 4e-36
 Identities = 84/86 (97%)
 Strand = Plus / Plus

                                                                       
Query: 156 gcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatg 215
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 4   gcgtgaggagagcggagccggacacaagagcagaggccgaactcgggatctgacaagatg 63

                                     
Query: 216 gccgggctgccccgcaggatcatcaa 241
           || |||||||||||||||||||||||
Sbjct: 64  gcngggctgccccgcaggatcatcaa 89
























[ summary ]

>|BQ956303.1|22371781| AGENCOURT_8752899 NIH_MGC_130 Mus musculus
           cDNA clone IMAGE:6335829 5', mRNA sequence
          Length = 950

 Score =  157 bits (79), Expect = 4e-36
 Identities = 79/79 (100%)
 Strand = Plus / Plus

                                                                       
Query: 163 gagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggc 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggc 60

                              
Query: 223 tgccccgcaggatcatcaa 241
           |||||||||||||||||||
Sbjct: 61  tgccccgcaggatcatcaa 79
























[ summary ]

>|CX733093.1|58035567| oc39b05.y1 No3 mouse (cataract/retinal
           degeneration) whole eye, unamplified: ob/oc Mus musculus
           cDNA clone oc39b05 5', mRNA sequence
          Length = 639

 Score =  153 bits (77), Expect = 6e-35
 Identities = 77/77 (100%)
 Strand = Plus / Plus

                                                                       
Query: 165 gagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctg 224
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctg 60

                            
Query: 225 ccccgcaggatcatcaa 241
           |||||||||||||||||
Sbjct: 61  ccccgcaggatcatcaa 77
























[ summary ]

>|CN455501.1|46461227| UI-M-HN0-coi-f-18-0-UI.r1 NIH_BMAP_HN0 Mus
           musculus cDNA clone IMAGE:30649001 5', mRNA sequence
          Length = 596

 Score =  153 bits (77), Expect = 6e-35
 Identities = 77/77 (100%)
 Strand = Plus / Plus

                                                                       
Query: 165 gagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctg 224
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctg 60

                            
Query: 225 ccccgcaggatcatcaa 241
           |||||||||||||||||
Sbjct: 61  ccccgcaggatcatcaa 77
























[ summary ]

>|BY156182.1|26292828| BY156182 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830006O14 5',
           mRNA sequence
          Length = 277

 Score =  151 bits (76), Expect = 2e-34
 Identities = 79/80 (98%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 9   ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaagtcgggatctg 68

                               
Query: 208 acaagatggccgggctgccc 227
           ||||||||||||||||||||
Sbjct: 69  acaagatggccgggctgccc 88
























[ summary ]

>|NM_080560.2|46048285| Mus musculus ubiquitin-conjugating enzyme
           E2N (Ube2n), mRNA
          Length = 3869

 Score =  149 bits (75), Expect = 5e-35
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 60

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 61  ccgcaggatcatcaa 75
























[ summary ]

>|CX220507.1|56875799| MNS36183 Mouse Neurosphere Normalized cDNA
           library Mus musculus cDNA 5', mRNA sequence
          Length = 813

 Score =  149 bits (75), Expect = 9e-34
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 60

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 61  ccgcaggatcatcaa 75
























[ summary ]

>|CF733055.1|37629388| UI-M-HB0-cka-j-17-0-UI.r1 NIH_BMAP_HB0 Mus
           musculus cDNA clone IMAGE:30550024 5', mRNA sequence
          Length = 769

 Score =  149 bits (75), Expect = 9e-34
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 60

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 61  ccgcaggatcatcaa 75
























[ summary ]

>|CA530025.1|25044091| 9024-18 Mouse E14.5 retina lambda ZAP II
           Library Mus musculus cDNA, mRNA sequence
          Length = 600

 Score =  149 bits (75), Expect = 9e-34
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 60

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 61  ccgcaggatcatcaa 75
























[ summary ]

>|BQ568431.1|21471748| gi108b06.y1 Mouse Organ of Corti cDNA
           pBluescript Mus musculus cDNA clone gi108b06 5', mRNA
           sequence
          Length = 186

 Score =  149 bits (75), Expect = 9e-34
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 60

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 61  ccgcaggatcatcaa 75
























[ summary ]

>|BQ567742.1|21471059| gi95f12.y1 Mouse Organ of Corti cDNA
           pBluescript Mus musculus cDNA clone gi95f12 5', mRNA
           sequence
          Length = 632

 Score =  149 bits (75), Expect = 9e-34
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 60

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 61  ccgcaggatcatcaa 75
























[ summary ]

>|BF607028.1|13503520| MY2_000148 Mouse 9-day fetus cDNA library
           MPMGp559 Mus musculus cDNA clone MPMGp559M1282 5', mRNA
           sequence
          Length = 754

 Score =  149 bits (75), Expect = 9e-34
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 48  gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 107

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 108 ccgcaggatcatcaa 122
























[ summary ]

>|BC067069.1|45219884|Mus musculus ubiquitin-conjugating enzyme E2N,
           mRNA (cDNA clone MGC:86116 IMAGE:30550024), complete
           cds.
          Length = 3869

 Score =  149 bits (75), Expect = 4e-33
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcc 60

                          
Query: 227 ccgcaggatcatcaa 241
           |||||||||||||||
Sbjct: 61  ccgcaggatcatcaa 75
























[ summary ]

>|CJ135371.1|76235699| CJ135371 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J bone marrow macrophage Mus
           musculus cDNA clone I830063J09 5', mRNA sequence
          Length = 427

 Score =  147 bits (74), Expect = 4e-33
 Identities = 82/85 (96%)
 Strand = Plus / Plus

                                                                       
Query: 156 gcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatg 215
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4   gcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatg 63

                                    
Query: 216 gccgggctgccccgcaggatcatca 240
           ||||||||| |||||| ||| ||||
Sbjct: 64  gccgggctggcccgcacgatnatca 88
























[ summary ]

>|CK620351.1|41341237| ml11b07.y1 Mouse retina, unamplified: mk/ml
           Mus musculus cDNA clone ml11b07 5', mRNA sequence
          Length = 645

 Score =  147 bits (74), Expect = 4e-33
 Identities = 74/74 (100%)
 Strand = Plus / Plus

                                                                       
Query: 168 cggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccc 227
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccc 60

                         
Query: 228 cgcaggatcatcaa 241
           ||||||||||||||
Sbjct: 61  cgcaggatcatcaa 74
























[ summary ]

>|BY158307.1|26294953| BY158307 RIKEN full-length enriched, bone
           marrow macrophage Mus musculus cDNA clone I830017E13 5',
           mRNA sequence
          Length = 440

 Score =  147 bits (74), Expect = 4e-33
 Identities = 91/94 (96%), Gaps = 2/94 (2%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 3   ccactcgagcgtgaggagagcggagc-ggagacaagagcagaggccgaactcgggatctg 61

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||| |||||| ||||||||||||||||
Sbjct: 62  acaagatggcggggctg-cccgcaggatcatcaa 94
























[ summary ]

>|W65672.1|1373888| me13d09.r1 Soares mouse embryo NbME13.5 14.5 Mus
           musculus cDNA clone IMAGE:387377 5' similar to
           SW:UBC5_DROME P35128 UBIQUITIN-CONJUGATING ENZYME E2-17
           KD ;, mRNA sequence
          Length = 460

 Score =  147 bits (74), Expect = 4e-33
 Identities = 89/94 (94%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           |||||||||||||||| |||||||  ||||||||||||||||||||||||||||||||||
Sbjct: 105 ccactcgagcgtgaggggagcggacgcggagacaagagcagaggccgaactcgggatctg 164

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||  |||||||
Sbjct: 165 acaagatggccgggctgccccgcagagtcatcaa 198
























[ summary ]

>|AV507667.1|140609904| AV507667 Abe mouse ES cell Mus musculus cDNA
           clone 20000119EK09F03, mRNA sequence
          Length = 513

 Score =  145 bits (73), Expect = 1e-32
 Identities = 80/81 (98%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                       
Query: 161 aggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgg 220
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   aggagagcggagc-ggagacaagagcagaggccgaactcgggatctgacaagatggccgg 59

                                
Query: 221 gctgccccgcaggatcatcaa 241
           |||||||||||||||||||||
Sbjct: 60  gctgccccgcaggatcatcaa 80
























[ summary ]

>|CV562835.1|54453924| UI-M-HL0-ctt-l-05-0-UI.r1 NIH_BMAP_HL0 Mus
           musculus cDNA clone IMAGE:30700972 5', mRNA sequence
          Length = 695

 Score =  145 bits (73), Expect = 1e-32
 Identities = 73/73 (100%)
 Strand = Plus / Plus

                                                                       
Query: 169 ggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcccc 228
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcccc 60

                        
Query: 229 gcaggatcatcaa 241
           |||||||||||||
Sbjct: 61  gcaggatcatcaa 73
























[ summary ]

>|XM_885442.2|94380513| PREDICTED: Mus musculus similar to
           ubiquitin-conjugating enzyme E2N (LOC620934), mRNA
          Length = 1236

 Score =  143 bits (72), Expect = 3e-33
 Identities = 75/76 (98%)
 Strand = Plus / Plus

                                                                       
Query: 166 agcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgc 225
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 23  agcggagccggagacaagagcagaggccgaacttgggatctgacaagatggccgggctgc 82

                           
Query: 226 cccgcaggatcatcaa 241
           ||||||||||||||||
Sbjct: 83  cccgcaggatcatcaa 98
























[ summary ]

>|XM_905142.2|94380497| PREDICTED: Mus musculus similar to
           ubiquitin-conjugating enzyme E2N (LOC620934), mRNA
          Length = 1236

 Score =  143 bits (72), Expect = 3e-33
 Identities = 75/76 (98%)
 Strand = Plus / Plus

                                                                       
Query: 166 agcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgc 225
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 23  agcggagccggagacaagagcagaggccgaacttgggatctgacaagatggccgggctgc 82

                           
Query: 226 cccgcaggatcatcaa 241
           ||||||||||||||||
Sbjct: 83  cccgcaggatcatcaa 98
























[ summary ]

>|XM_973165.1|94382300| PREDICTED: Mus musculus similar to
           ubiquitin-conjugating enzyme E2N (LOC620934), mRNA
          Length = 1236

 Score =  143 bits (72), Expect = 3e-33
 Identities = 75/76 (98%)
 Strand = Plus / Plus

                                                                       
Query: 166 agcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgc 225
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 23  agcggagccggagacaagagcagaggccgaacttgggatctgacaagatggccgggctgc 82

                           
Query: 226 cccgcaggatcatcaa 241
           ||||||||||||||||
Sbjct: 83  cccgcaggatcatcaa 98
























[ summary ]

>|NT_039428.6|94380591|Mus musculus chromosome 7 genomic contig, strain
               C57BL/6J
          Length = 22508268

 Score =  143 bits (72), Expect = 7e-32
 Identities = 75/76 (98%)
 Strand = Plus / Minus

                                                                           
Query: 166     agcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgc 225
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1813994 agcggagccggagacaagagcagaggccgaacttgggatctgacaagatggccgggctgc 1813935

                               
Query: 226     cccgcaggatcatcaa 241
               ||||||||||||||||
Sbjct: 1813934 cccgcaggatcatcaa 1813919
























[ summary ]

>|AC119249.7|58000577|Mus musculus chromosome 7, clone RP24-274B19,
              complete sequence.
          Length = 182985

 Score =  143 bits (72), Expect = 3e-31
 Identities = 75/76 (98%)
 Strand = Plus / Plus

                                                                          
Query: 166    agcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgc 225
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 170520 agcggagccggagacaagagcagaggccgaacttgggatctgacaagatggccgggctgc 170579

                              
Query: 226    cccgcaggatcatcaa 241
              ||||||||||||||||
Sbjct: 170580 cccgcaggatcatcaa 170595
























[ summary ]

>|AC151472.2|62526269|Mus musculus BAC clone RP23-407N2 from chromosome 7,
              complete sequence.
          Length = 196583

 Score =  143 bits (72), Expect = 3e-31
 Identities = 75/76 (98%)
 Strand = Plus / Minus

                                                                          
Query: 166    agcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgc 225
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 178259 agcggagccggagacaagagcagaggccgaacttgggatctgacaagatggccgggctgc 178200

                              
Query: 226    cccgcaggatcatcaa 241
              ||||||||||||||||
Sbjct: 178199 cccgcaggatcatcaa 178184
























[ summary ]

>|BU512034.1|22818267| AGENCOURT_10115731 NIH_MGC_134 Mus musculus
           cDNA clone IMAGE:6506885 5', mRNA sequence
          Length = 1006

 Score =  141 bits (71), Expect = 2e-31
 Identities = 77/79 (97%)
 Strand = Plus / Plus

                                                                       
Query: 163 gagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggc 222
           ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 8   gagagcggagccggagacaagtgccgaggccgaactcgggatctgacaagatggccgggc 67

                              
Query: 223 tgccccgcaggatcatcaa 241
           |||||||||||||||||||
Sbjct: 68  tgccccgcaggatcatcaa 86
























[ summary ]

>|NM_003348.3|37577134| Homo sapiens ubiquitin-conjugating enzyme
           E2N (UBC13 homolog, yeast) (UBE2N), mRNA
          Length = 2568

 Score =  139 bits (70), Expect = 4e-32
 Identities = 88/94 (93%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||| |||||||| ||| |||||||||||| ||| ||||||||||||||||| ||||
Sbjct: 302 ccactcgtgcgtgaggcgagaggagccggagacgagaccagaggccgaactcgggttctg 361

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 362 acaagatggccgggctgccccgcaggatcatcaa 395
























[ summary ]

>|CJ149568.1|76249941| CJ149568 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J visual cortex Mus musculus cDNA
           clone K330309F15 5', mRNA sequence
          Length = 373

 Score =  139 bits (70), Expect = 9e-31
 Identities = 78/81 (96%)
 Strand = Plus / Plus

                                                                       
Query: 160 gaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggccg 219
           |||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 2   gaggggagcggagcnggagacaagagcagaggccgaactcgggatctgacaacatggccg 61

                                
Query: 220 ggctgccccgcaggatcatca 240
           |||||||||||||||||||||
Sbjct: 62  ggctgccccgcaggatcatca 82
























[ summary ]

>|BQ749025.1|21895812| UI-M-FB0-bxy-j-08-0-UI.r1 NIH_BMAP_FB0 Mus
           musculus cDNA clone IMAGE:5714791 5', mRNA sequence
          Length = 766

 Score =  139 bits (70), Expect = 9e-31
 Identities = 70/70 (100%)
 Strand = Plus / Plus

                                                                       
Query: 172 gccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgca 231
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgca 60

                     
Query: 232 ggatcatcaa 241
           ||||||||||
Sbjct: 61  ggatcatcaa 70
























[ summary ]

>|AC025260.29|23306054|Homo sapiens 12 BAC RP11-356O22 (Roswell Park
              Cancer Institute Human BAC Library) complete sequence.
          Length = 164872

 Score =  139 bits (70), Expect = 4e-30
 Identities = 88/94 (93%)
 Strand = Plus / Plus

                                                                          
Query: 148    ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
              ||||||| |||||||| ||| |||||||||||| ||| ||||||||||||||||| ||||
Sbjct: 119822 ccactcgtgcgtgaggcgagaggagccggagacgagaccagaggccgaactcgggttctg 119881

                                                
Query: 208    acaagatggccgggctgccccgcaggatcatcaa 241
              ||||||||||||||||||||||||||||||||||
Sbjct: 119882 acaagatggccgggctgccccgcaggatcatcaa 119915
























[ summary ]

>|BC000396.2|33875387|Homo sapiens ubiquitin-conjugating enzyme E2N
           (UBC13 homolog, yeast), mRNA (cDNA clone MGC:8489
           IMAGE:2822013), complete cds.
          Length = 1250

 Score =  139 bits (70), Expect = 4e-30
 Identities = 88/94 (93%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||| |||||||| ||| |||||||||||| ||| ||||||||||||||||| ||||
Sbjct: 28  ccactcgtgcgtgaggcgagaggagccggagacgagaccagaggccgaactcgggttctg 87

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||
Sbjct: 88  acaagatggccgggctgccccgcaggatcatcaa 121
























[ summary ]

>|AB169913.1|67971303|Macaca fascicularis brain cDNA, clone:
           QtrA-13863, similar to human ubiquitin-conjugating
           enzyme E2N (UBC13 homolog, yeast)(UBE2N), mRNA, RefSeq:
           NM_003348.3.
          Length = 2234

 Score =  139 bits (70), Expect = 4e-30
 Identities = 88/94 (93%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           ||||||| |||||||| |||||||||||||||| ||| ||||||||||||||||| ||||
Sbjct: 13  ccactcgtgcgtgaggcgagcggagccggagacgagaccagaggccgaactcgggttctg 72

                                             
Query: 208 acaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||| |||||||||||||||||
Sbjct: 73  acaagatggccgggctaccccgcaggatcatcaa 106
























[ summary ]

>|BQ899535.1|22291549| AGENCOURT_8749030 NIH_MGC_130 Mus musculus
           cDNA clone IMAGE:6334412 5', mRNA sequence
          Length = 929

 Score =  137 bits (69), Expect = 4e-30
 Identities = 69/69 (100%)
 Strand = Plus / Plus

                                                                       
Query: 173 ccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcag 232
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcag 60

                    
Query: 233 gatcatcaa 241
           |||||||||
Sbjct: 61  gatcatcaa 69
























[ summary ]

>|D77762.1|1597558| MUSB8D06 mouse embryonal carcinoma cell line F9
           Mus musculus cDNA clone B8D06, mRNA sequence
          Length = 316

 Score =  137 bits (69), Expect = 4e-30
 Identities = 72/73 (98%)
 Strand = Plus / Plus

                                                                       
Query: 169 ggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcccc 228
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1   ggagccggagacaagagcagaggccgaactcgggatctaacaagatggccgggctgcccc 60

                        
Query: 229 gcaggatcatcaa 241
           |||||||||||||
Sbjct: 61  gcaggatcatcaa 73
























[ summary ]

>|AV454796.1|140556151| AV454796 Abe mouse ES cell Mus musculus cDNA
           clone 19990806EK08B02, mRNA sequence
          Length = 466

 Score =  133 bits (67), Expect = 5e-29
 Identities = 67/67 (100%)
 Strand = Plus / Plus

                                                                       
Query: 175 ggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcagga 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcagga 60

                  
Query: 235 tcatcaa 241
           |||||||
Sbjct: 61  tcatcaa 67
























[ summary ]

>|BU938063.1|24126882| AGENCOURT_10521280 NIH_MGC_169 Mus musculus
           cDNA clone IMAGE:6706107 5', mRNA sequence
          Length = 863

 Score =  133 bits (67), Expect = 5e-29
 Identities = 85/91 (93%)
 Strand = Plus / Plus

                                                                       
Query: 148 ccactcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctg 207
           |||||||||||||||||||| || ||||||||  |||  |||||||||||||||||||||
Sbjct: 270 ccactcgagcgtgaggagagtggcgccggagagcagattagaggccgaactcgggatctg 329

                                          
Query: 208 acaagatggccgggctgccccgcaggatcat 238
           |||||||||||||||||||||||||||||||
Sbjct: 330 acaagatggccgggctgccccgcaggatcat 360
























[ summary ]

>|BU604552.1|23256311| AGENCOURT_10050112 NIH_MGC_144 Mus musculus
           cDNA clone IMAGE:6531844 5', mRNA sequence
          Length = 785

 Score =  133 bits (67), Expect = 5e-29
 Identities = 67/67 (100%)
 Strand = Plus / Plus

                                                                       
Query: 175 ggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcagga 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   ggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcagga 61

                  
Query: 235 tcatcaa 241
           |||||||
Sbjct: 62  tcatcaa 68
























[ summary ]

>|CX565418.1|57592447| UI-M-HA0-cuk-b-03-0-UI.r1 NIH_BMAP_HA0 Mus
           musculus cDNA clone IMAGE:30940250 5', mRNA sequence
          Length = 800

 Score =  131 bits (66), Expect = 2e-28
 Identities = 66/66 (100%)
 Strand = Plus / Plus

                                                                       
Query: 176 gagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggat 235
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggat 60

                 
Query: 236 catcaa 241
           ||||||
Sbjct: 61  catcaa 66
























[ summary ]

>|BY124529.1|26235630| BY124529 RIKEN full-length enriched, adult
           male brain Mus musculus cDNA clone L630026B06 5', mRNA
           sequence
          Length = 326

 Score =  127 bits (64), Expect = 3e-27
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                       
Query: 178 gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 237
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 61

               
Query: 238 tcaa 241
           ||||
Sbjct: 62  tcaa 65
























[ summary ]

>|NT_109320.3|94375121|Mus musculus chromosome 5 genomic contig, strain
              C57BL/6J
          Length = 36574280

 Score =  127 bits (64), Expect = 4e-27
 Identities = 64/64 (100%)
 Strand = Plus / Minus

                                                                          
Query: 178    gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 237
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120176 gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 120117

                  
Query: 238    tcaa 241
              ||||
Sbjct: 120116 tcaa 120113
























[ summary ]

>|AC124468.3|40949622|Mus musculus BAC clone RP24-165F16 from chromosome
              5, complete sequence.
          Length = 169280

 Score =  127 bits (64), Expect = 2e-26
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                          
Query: 178    gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 237
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 128909 gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 128968

                  
Query: 238    tcaa 241
              ||||
Sbjct: 128969 tcaa 128972
























[ summary ]

>|AY039837.1|15020281|Mus musculus E2 ubiquitin conjugating enzyme
           UBC13 (Ubc13) mRNA, complete cds.
          Length = 606

 Score =  127 bits (64), Expect = 2e-26
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                       
Query: 178 gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 237
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21  gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 80

               
Query: 238 tcaa 241
           ||||
Sbjct: 81  tcaa 84
























[ summary ]

>|AF146793.2|7684609|Mus musculus Neuromedin U precursor (Nmu) gene,
              partial cds; PDCL2 (Pdcl2) gene, partial cds; CLOCK (Clock)
              gene, complete cds; TPARDL (Tpardl) gene, complete cds; and
              SRD5A2L (Srd5a2l) gene, complete cds.
          Length = 204618

 Score =  127 bits (64), Expect = 2e-26
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                          
Query: 178    gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 237
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 105893 gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 105952

                  
Query: 238    tcaa 241
              ||||
Sbjct: 105953 tcaa 105956
























[ summary ]

>|AC147239.2|48675523|Mus musculus BAC clone RP23-386C10 from chromosome
             5, complete sequence.
          Length = 217470

 Score =  127 bits (64), Expect = 2e-26
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                         
Query: 178   gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 237
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 97295 gacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatca 97354

                 
Query: 238   tcaa 241
             ||||
Sbjct: 97355 tcaa 97358
























[ summary ]

>|BY206848.1|26386764| BY206848 RIKEN full-length enriched,
           B6-derived CD11 +ve dendritic cells Mus musculus cDNA
           clone F730225O12 5', mRNA sequence
          Length = 361

 Score =  125 bits (63), Expect = 1e-26
 Identities = 84/87 (96%), Gaps = 3/87 (3%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgg-gatct-gacaagatg 215
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 2   gtgaggagagcggagccggagacaagagcagaggccgaactcggtgatctggacaagatg 61

                                      
Query: 216 g-ccgggctgccccgcaggatcatcaa 241
           | |||||||||||||||||||||||||
Sbjct: 62  gcccgggctgccccgcaggatcatcaa 88
























[ summary ]

>|AA271547.1|1909910| vb74e11.r1 Soares mouse 3NME12 5 Mus musculus
           cDNA clone IMAGE:762764 5' similar to TR:G1181558
           G1181558 UBIQUITIN-CONJUGATING ENZYME E2 ;, mRNA
           sequence
          Length = 456

 Score =  125 bits (63), Expect = 1e-26
 Identities = 63/63 (100%)
 Strand = Plus / Plus

                                                                       
Query: 179 acaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcat 238
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   acaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcat 60

              
Query: 239 caa 241
           |||
Sbjct: 61  caa 63
























[ summary ]

>|CX240779.1|56896071| NMA03569 Mus Musculus Lateral Ventricle Wall
           C57BL/6 adult Mus musculus cDNA 5', mRNA sequence
          Length = 714

 Score =  123 bits (62), Expect = 5e-26
 Identities = 62/62 (100%)
 Strand = Plus / Plus

                                                                       
Query: 180 caagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatc 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   caagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatc 60

             
Query: 240 aa 241
           ||
Sbjct: 61  aa 62
























[ summary ]

>|BQ930129.1|22345160| AGENCOURT_8952698 NCI_CGAP_Co24 Mus musculus
           cDNA clone IMAGE:6475228 5', mRNA sequence
          Length = 1054

 Score =  121 bits (61), Expect = 2e-25
 Identities = 61/61 (100%)
 Strand = Plus / Plus

                                                                       
Query: 181 aagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   aagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatca 60

            
Query: 241 a 241
           |
Sbjct: 61  a 61
























[ summary ]

>|BC108704.1|80479361|Homo sapiens ubiquitin-conjugating enzyme E2N
           (UBC13 homolog, yeast), mRNA (cDNA clone MGC:131857
           IMAGE:6503770), complete cds.
          Length = 1216

 Score =  121 bits (61), Expect = 1e-24
 Identities = 70/73 (95%)
 Strand = Plus / Plus

                                                                       
Query: 169 ggagccggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgcccc 228
           |||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 18  ggagccggagacgagaccagaggccgaactcgggttctgacaagatggccgggctgcccc 77

                        
Query: 229 gcaggatcatcaa 241
           |||||||||||||
Sbjct: 78  gcaggatcatcaa 90
























[ summary ]

>|D28664.1|618981| MUS88D03 mouse embryonal carcinoma cell line F9
           Mus musculus cDNA clone 88D03, mRNA sequence
          Length = 168

 Score =  119 bits (60), Expect = 8e-25
 Identities = 67/68 (98%), Gaps = 1/68 (1%)
 Strand = Plus / Plus

                                                                       
Query: 174 cggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcagg 233
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 6   cggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgca-g 64

                   
Query: 234 atcatcaa 241
           ||||||||
Sbjct: 65  atcatcaa 72
























[ summary ]

>|AC024451.8|21637522|Homo sapiens chromosome 11, clone RP11-697N18,
              complete sequence.
          Length = 159791

 Score =  119 bits (60), Expect = 4e-24
 Identities = 84/92 (91%)
 Strand = Plus / Minus

                                                                          
Query: 150    actcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgac 209
              ||||| ||||||||  ||||||||||||||| ||| ||||||||||||||||| ||||| 
Sbjct: 117923 actcgtgcgtgaggcaagcggagccggagactagaccagaggccgaactcgggttctgat 117864

                                              
Query: 210    aagatggccgggctgccccgcaggatcatcaa 241
              |||||||| |||||||||||||||||||||||
Sbjct: 117863 aagatggcagggctgccccgcaggatcatcaa 117832
























[ summary ]

>|AV463514.1|140590465| AV463514 Abe mouse ES cell Mus musculus cDNA
           clone 19990830EK06C12, mRNA sequence
          Length = 407

 Score =  113 bits (57), Expect = 5e-23
 Identities = 57/57 (100%)
 Strand = Plus / Plus

                                                                    
Query: 185 gcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   gcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 59
























[ summary ]

>|CJ135631.1|76235959| CJ135631 RIKEN full-length enriched mouse
           cDNA library, C57BL/6J bone marrow macrophage Mus
           musculus cDNA clone I830093N17 5', mRNA sequence
          Length = 389

 Score =  113 bits (57), Expect = 5e-23
 Identities = 79/85 (92%), Gaps = 1/85 (1%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagat-gg 216
           ||||||||||||| |||||||||||||||||||| |||||||||||||||| ||||| ||
Sbjct: 1   gtgaggagagcggggccggagacaagagcagagggcgaactcgggatctgagaagatggg 60

                                    
Query: 217 ccgggctgccccgcaggatcatcaa 241
           |||||||| ||||||||||| ||||
Sbjct: 61  ccgggctggcccgcaggatcttcaa 85
























[ summary ]

>|BI685075.1|15647703| 603310060F1 NCI_CGAP_Mam6 Mus musculus cDNA
           clone IMAGE:5346086 5', mRNA sequence
          Length = 57

 Score =  113 bits (57), Expect = 5e-23
 Identities = 57/57 (100%)
 Strand = Plus / Plus

                                                                    
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 57
























[ summary ]

>|BG873447.1|14223987| 602791062F1 NCI_CGAP_SG2 Mus musculus cDNA
           clone IMAGE:4922270 5', mRNA sequence
          Length = 57

 Score =  113 bits (57), Expect = 5e-23
 Identities = 57/57 (100%)
 Strand = Plus / Plus

                                                                    
Query: 162 ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 57
























[ summary ]

>|CN457491.1|46463217| UI-M-HP0-cok-l-04-0-UI.r1 NIH_BMAP_HP0 Mus
           musculus cDNA clone IMAGE:30656811 5', mRNA sequence
          Length = 736

 Score =  111 bits (56), Expect = 2e-22
 Identities = 56/56 (100%)
 Strand = Plus / Plus

                                                                   
Query: 186 cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 56
























[ summary ]

>|CA880981.1|27332530| K0987B06-5N NIA Mouse Neural Stem Cell
           (Undifferentiated) cDNA Library (Long) Mus musculus cDNA
           clone NIA:K0987B06 IMAGE:30092561 5', mRNA sequence
          Length = 516

 Score =  111 bits (56), Expect = 2e-22
 Identities = 56/56 (100%)
 Strand = Plus / Plus

                                                                   
Query: 186 cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 56
























[ summary ]

>|BI733686.1|15710699| 603354887F1 NIH_MGC_94 Mus musculus cDNA
           clone IMAGE:5362365 5', mRNA sequence
          Length = 56

 Score =  111 bits (56), Expect = 2e-22
 Identities = 56/56 (100%)
 Strand = Plus / Plus

                                                                   
Query: 163 gagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 218
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 56
























[ summary ]

>|AC148448.3|73912751|Pan troglodytes chromosome X clone PTB-007I07 map
             human ortholog q22.1, complete sequence.
          Length = 44375

 Score =  111 bits (56), Expect = 9e-22
 Identities = 65/68 (95%)
 Strand = Plus / Minus

                                                                         
Query: 174   cggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcagg 233
             ||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 18364 cggagacgagaccagaggccgaactcgggttctgacaagatggccgggctgccccgcagg 18305

                     
Query: 234   atcatcaa 241
             ||||||||
Sbjct: 18304 atcatcaa 18297
























[ summary ]

>|BY032917.1|26138360| BY032917 RIKEN full-length enriched, 13 days
           pregnant adult female placenta Mus musculus cDNA clone
           I530001H05 5', mRNA sequence
          Length = 394

 Score =  109 bits (55), Expect = 8e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 187 agaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   agaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 56
























[ summary ]

>|BM936779.1|19395931| UI-M-CG0p-bqc-a-02-0-UI.r1 NIH_BMAP_Ret4_S2
           Mus musculus cDNA clone UI-M-CG0p-bqc-a-02-0-UI 5', mRNA
           sequence
          Length = 373

 Score =  109 bits (55), Expect = 8e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 187 agaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   agaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 55
























[ summary ]

>|DV047773.1|76375056| DAY20_19_B06.x1 FH DAY20 Mus musculus cDNA
           clone DAY20_19_B06 similar to Ubiquitin-conjugating
           enzyme E2N, mRNA sequence
          Length = 956

 Score =  107 bits (54), Expect = 3e-21
 Identities = 54/54 (100%)
 Strand = Plus / Plus

                                                                 
Query: 188 gaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20  gaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 73
























[ summary ]

>|BY775803.1|39702441| BY775803 RIKEN full-length enriched, 17.5
           days embryo whole body Mus musculus cDNA clone
           L930098I08 5', mRNA sequence
          Length = 351

 Score =  107 bits (54), Expect = 3e-21
 Identities = 54/54 (100%)
 Strand = Plus / Plus

                                                                 
Query: 188 gaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   gaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 55
























[ summary ]

>|BG294478.1|13055152| 602391595F1 NIH_MGC_94 Mus musculus cDNA
           clone IMAGE:4503382 5', mRNA sequence
          Length = 62

 Score =  107 bits (54), Expect = 3e-21
 Identities = 61/62 (98%), Gaps = 1/62 (1%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtgaggagagcggagccggagacaa-gagcagaggccgaactcgggatctgacaagatgg 216
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1   gtgaggagagcggagccggagacaatgagcagaggccgaactcgggatctgacaagatgg 60

             
Query: 217 cc 218
           ||
Sbjct: 61  cc 62
























[ summary ]

>|BB577941.1|11474485| BB577941 RIKEN full-length enriched, adult
           male medulla oblongata Mus musculus cDNA clone
           6330501I15 5', mRNA sequence
          Length = 257

 Score =  107 bits (54), Expect = 3e-21
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                       
Query: 152 tcgagcgtgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaa 211
           |||||||| |||| |||||| ||||| | || |||||| |||||||||||||||||||||
Sbjct: 1   tcgagcgtaaggaaagcggaaccggaaaaaaaagcagaagccgaactcgggatctgacaa 60

                                         
Query: 212 gatggccgggctgccccgcaggatcatcaa 241
            | |||||||||||||||||||||||||||
Sbjct: 61  aaaggccgggctgccccgcaggatcatcaa 90
























[ summary ]

>|DV049827.1|76377110| DAY35S_07_A21.x1 FH DAY35S Mus musculus cDNA
           clone DAY35S_07_A21 similar to Ubiquitin-conjugating
           enzyme E2N, mRNA sequence
          Length = 932

 Score =  105 bits (53), Expect = 1e-20
 Identities = 60/61 (98%), Gaps = 1/61 (1%)
 Strand = Plus / Plus

                                                                       
Query: 181 aagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatca 240
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 21  aagagcagaggccgaactcgggatctgaca-gatggccgggctgccccgcaggatcatca 79

            
Query: 241 a 241
           |
Sbjct: 80  a 80
























[ summary ]

>|DV045140.1|76372404| DAY20_08_B15.x1 FH DAY20 Mus musculus cDNA
           clone DAY20_08_B15 similar to Ubiquitin-conjugating
           enzyme E2N, mRNA sequence
          Length = 901

 Score =  105 bits (53), Expect = 1e-20
 Identities = 53/53 (100%)
 Strand = Plus / Plus

                                                                
Query: 189 aggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36  aggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 88
























[ summary ]

>|CK333557.1|40233229| H8249D10-5 NIA Mouse Unique Gene Set Version
           2 Mus musculus cDNA clone H8249D10 5', mRNA sequence
          Length = 563

 Score =  103 bits (52), Expect = 5e-20
 Identities = 52/52 (100%)
 Strand = Plus / Plus

                                                               
Query: 190 ggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 52
























[ summary ]

>|CA542229.1|25084793| C0616D06-5N NIA Mouse Trophoblast Stem Cell
           cDNA Library (Long) Mus musculus cDNA clone NIA:C0616D06
           IMAGE:30021737 5', mRNA sequence
          Length = 563

 Score =  103 bits (52), Expect = 5e-20
 Identities = 52/52 (100%)
 Strand = Plus / Plus

                                                               
Query: 190 ggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 52
























[ summary ]

>|BC034898.1|22028189|Mus musculus ubiquitin-conjugating enzyme E2N,
           mRNA (cDNA clone MGC:41464 IMAGE:1382079), complete cds.
          Length = 743

 Score =  103 bits (52), Expect = 2e-19
 Identities = 52/52 (100%)
 Strand = Plus / Plus

                                                               
Query: 190 ggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 52
























[ summary ]

>|BC003365.1|13097194|Homo sapiens ubiquitin-conjugating enzyme E2N
           (UBC13 homolog, yeast), mRNA (cDNA clone MGC:5063
           IMAGE:2900313), complete cds.
          Length = 1185

 Score =  103 bits (52), Expect = 2e-19
 Identities = 55/56 (98%)
 Strand = Plus / Plus

                                                                   
Query: 186 cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cagaggccgaactcgggttctgacaagatggccgggctgccccgcaggatcatcaa 56
























[ summary ]

>|BC119931.1|112362018|Bos taurus similar to ubiquitin-conjugating
           enzyme E2N (homologous to yeast UBC13), mRNA (cDNA clone
           MGC:139855 IMAGE:8284310), complete cds.
          Length = 2218

 Score =  103 bits (52), Expect = 2e-19
 Identities = 55/56 (98%)
 Strand = Plus / Plus

                                                                   
Query: 186 cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 7   cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggattatcaa 62
























[ summary ]

>|BG294616.1|13055426| 602391957F1 NIH_MGC_94 Mus musculus cDNA
           clone IMAGE:4503470 5', mRNA sequence
          Length = 51

 Score =  101 bits (51), Expect = 2e-19
 Identities = 51/51 (100%)
 Strand = Plus / Plus

                                                              
Query: 168 cggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 51
























[ summary ]

>|AL034974.1|6646600| r8710a05 Beddington mouse dissected endoderm
           Mus musculus cDNA clone 528_9D2 5', mRNA sequence
          Length = 510

 Score =  101 bits (51), Expect = 2e-19
 Identities = 51/51 (100%)
 Strand = Plus / Plus

                                                              
Query: 191 gccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 51
























[ summary ]

>|AC188064.1|109715949|Callithrix jacchus chromosome UNK clone
              CH259-78H12, complete sequence.
          Length = 202506

 Score =  101 bits (51), Expect = 9e-19
 Identities = 63/67 (94%)
 Strand = Plus / Plus

                                                                          
Query: 175    ggagacaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcagga 234
              |||||| ||| ||||||||||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 151926 ggagacgagaccagaggccgaactcgggttctgacaagatggccgggctgccctgcagga 151985

                     
Query: 235    tcatcaa 241
              |||||||
Sbjct: 151986 tcatcaa 151992
























[ summary ]

>|BC132630.1|124376821|Mus musculus ubiquitin-conjugating enzyme
           E2N, mRNA (cDNA clone MGC:164261 IMAGE:40130907),
           complete cds.
          Length = 1687

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 50/50 (100%)
 Strand = Plus / Plus

                                                             
Query: 192 ccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 50
























[ summary ]

>|CX222629.1|56877921| MNS39283 Mouse Neurosphere Normalized cDNA
           library Mus musculus cDNA 5', mRNA sequence
          Length = 729

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 72/77 (93%), Gaps = 2/77 (2%)
 Strand = Plus / Plus

                                                                       
Query: 167 gcggagccggagacaagag-cagaggccga-actcgggatctgacaagatggccgggctg 224
           ||||||||||| |||| || || ||||||| |||||||||||||||||||||||||||||
Sbjct: 1   gcggagccggatacaaaaggcacaggccgatactcgggatctgacaagatggccgggctg 60

                            
Query: 225 ccccgcaggatcatcaa 241
           |||||||||||||||||
Sbjct: 61  ccccgcaggatcatcaa 77
























[ summary ]

>|CD355277.1|31147778| UI-M-FY0-cgl-n-09-0-UI.r1 NIH_BMAP_FY0 Mus
           musculus cDNA clone IMAGE:30354464 5', mRNA sequence
          Length = 401

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                            
Query: 193 cgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 49
























[ summary ]

>|AA982879.1|3161538| ub59h08.r1 Soares_mammary_gland_NMLMG Mus
           musculus cDNA clone IMAGE:1382079 5' similar to
           SW:UBCC_HUMAN Q16781 UBIQUITIN-CONJUGATING ENZYME E2-17
           KD ;, mRNA sequence
          Length = 477

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                            
Query: 193 cgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   cgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 51
























[ summary ]

>|DV067921.1|76395219| UGS01_13_I23.x1 FH UGS01 Mus musculus cDNA
           clone UGS01_13_I23 similar to Circadian locomoter output
           cycles kaput, mRNA sequence
          Length = 926

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 55/56 (98%), Gaps = 1/56 (1%)
 Strand = Plus / Plus

                                                                   
Query: 186 cagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 23  cagaggccgaactcgggatctgacaaga-ggccgggctgccccgcaggatcatcaa 77
























[ summary ]

>|CJ068843.1|76151132| CJ068843 RIKEN full-length enriched mouse
           cDNA library, pooled tissue 3 Mus musculus cDNA clone
           G430011J01 5', mRNA sequence
          Length = 460

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 83/92 (90%), Gaps = 2/92 (2%)
 Strand = Plus / Plus

                                                                       
Query: 152 tcgagcgtgaggagagcgg-agcc-ggagacaagagcagaggccgaactcgggatctgac 209
           ||||| ||||||||||||| |||| ||| | || || |||||||||||||||||||||||
Sbjct: 11  tcgagggtgaggagagcgggagcccggaaaaaaaagaagaggccgaactcgggatctgac 70

                                           
Query: 210 aagatggccgggctgccccgcaggatcatcaa 241
           || ||||||||||||||||||||||| |||||
Sbjct: 71  aaaatggccgggctgccccgcaggataatcaa 102
























[ summary ]

>|CF731656.1|37627986| UI-M-HA0-cjv-e-17-0-UI.r1 NIH_BMAP_HA0 Mus
           musculus cDNA clone IMAGE:30551440 5', mRNA sequence
          Length = 740

 Score = 91.7 bits (46), Expect = 2e-16
 Identities = 46/46 (100%)
 Strand = Plus / Plus

                                                         
Query: 196 actcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   actcgggatctgacaagatggccgggctgccccgcaggatcatcaa 46
























[ summary ]

>|AV498533.1|140548082| AV498533 Abe mouse ES cell Mus musculus cDNA
           clone 19991203EK11B07, mRNA sequence
          Length = 475

 Score = 89.7 bits (45), Expect = 7e-16
 Identities = 52/53 (98%), Gaps = 1/53 (1%)
 Strand = Plus / Plus

                                                                
Query: 190 ggccgaactc-gggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   ggccgaactccgggatctgacaagatggccgggctgccccgcaggatcatcaa 55
























[ summary ]

>|CF952004.1|38467873| UI-M-HL0-cnc-l-24-0-UI.r1 NIH_BMAP_HL0 Mus
           musculus cDNA clone IMAGE:30634175 5', mRNA sequence
          Length = 730

 Score = 89.7 bits (45), Expect = 7e-16
 Identities = 45/45 (100%)
 Strand = Plus / Plus

                                                        
Query: 197 ctcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ctcgggatctgacaagatggccgggctgccccgcaggatcatcaa 45
























[ summary ]

>|AV448575.1|140493373| AV448575 Abe mouse ES cell Mus musculus cDNA
           clone 19990723EK05B01, mRNA sequence
          Length = 484

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                       
Query: 198 tcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tcgggatctgacaagatggccgggctgccccgcaggatcatcaa 44
























[ summary ]

>|CD352707.1|31145208| UI-M-GL0-cfy-b-24-0-UI.r1 NIH_BMAP_GL0 Mus
           musculus cDNA clone IMAGE:30359183 5', mRNA sequence
          Length = 740

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                       
Query: 198 tcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tcgggatctgacaagatggccgggctgccccgcaggatcatcaa 44
























[ summary ]

>|BU510933.1|22817166| AGENCOURT_10120051 NIH_MGC_134 Mus musculus
           cDNA clone IMAGE:6505664 5', mRNA sequence
          Length = 1004

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 51/52 (98%), Gaps = 1/52 (1%)
 Strand = Plus / Plus

                                                               
Query: 190 ggccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 29  ggccgaactcgggatctgaca-gatggccgggctgccccgcaggatcatcaa 79
























[ summary ]

>|BQ922699.1|22337730| AGENCOURT_8909160 NCI_CGAP_Mam2 Mus musculus
           cDNA clone IMAGE:6440888 5', mRNA sequence
          Length = 1012

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                       
Query: 198 tcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12  tcgggatctgacaagatggccgggctgccccgcaggatcatcaa 55
























[ summary ]

>|NT_039589.6|94395369|Mus musculus chromosome 13 genomic contig, strain
                C57BL/6J
          Length = 38098852

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                            
Query: 179      acaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcat 238
                |||| |||||||||| |||||||||||||||||||||||| |||||||| |||| |||||
Sbjct: 18443655 acaaaagcagaggccaaactcgggatctgacaagatggccaggctgccctgcagaatcat 18443714

                   
Query: 239      caa 241
                |||
Sbjct: 18443715 caa 18443717
























[ summary ]

>|AV478484.1|140602411| AV478484 Abe mouse ES cell Mus musculus cDNA
           clone 19991021EK08F04, mRNA sequence
          Length = 510

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 50/51 (98%), Gaps = 1/51 (1%)
 Strand = Plus / Plus

                                                              
Query: 191 gccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 2   gccgaactcgggatctgaca-gatggccgggctgccccgcaggatcatcaa 51
























[ summary ]

>|CF732951.1|37629284| UI-M-HB0-cka-g-10-0-UI.r1 NIH_BMAP_HB0 Mus
           musculus cDNA clone IMAGE:30549945 5', mRNA sequence
          Length = 729

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 43/43 (100%)
 Strand = Plus / Plus

                                                      
Query: 199 cgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cgggatctgacaagatggccgggctgccccgcaggatcatcaa 43
























[ summary ]

>|BU056811.1|22496888| UI-M-FO0-bzz-h-05-0-UI.r1 NIH_BMAP_FO0 Mus
           musculus cDNA clone IMAGE:6412852 5', mRNA sequence
          Length = 705

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 43/43 (100%)
 Strand = Plus / Plus

                                                      
Query: 199 cgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cgggatctgacaagatggccgggctgccccgcaggatcatcaa 43
























[ summary ]

>|BI735526.1|15712539| 603357635F1 NIH_MGC_94 Mus musculus cDNA
           clone IMAGE:5364849 5', mRNA sequence
          Length = 59

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 57/59 (96%), Gaps = 2/59 (3%)
 Strand = Plus / Plus

                                                                      
Query: 162 ggagagcggagccggagacaa-gagcagaggccgaactcg-ggatctgacaagatggcc 218
           ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||
Sbjct: 1   ggagagcggagccggagacaacgagcagaggccgaactcgtggatctgacaagatggcc 59
























[ summary ]

>|CT025645.16|87080626|Mouse DNA sequence from clone RP23-233D21 on
              chromosome 13, complete sequence.
          Length = 225179

 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                          
Query: 179    acaagagcagaggccgaactcgggatctgacaagatggccgggctgccccgcaggatcat 238
              |||| |||||||||| |||||||||||||||||||||||| |||||||| |||| |||||
Sbjct: 155215 acaaaagcagaggccaaactcgggatctgacaagatggccaggctgccctgcagaatcat 155156

                 
Query: 239    caa 241
              |||
Sbjct: 155155 caa 155153
























[ summary ]

>|AE000658.1|2358019|Homo sapiens T-cell receptor alpha delta locus from
              bases 1 to 250529 (section 1 of 5) of the Complete
              Nucleotide Sequence.
          Length = 250529

 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                          
Query: 159    tgaggagagcggagccggagacaagagcagaggccgaactcgggatctgacaagatggcc 218
              ||||| ||| ||||||||||||  || |||||| |||||||||| |||||||||||||| 
Sbjct: 118233 tgaggggagtggagccggagacgggaccagaggtcgaactcgggttctgacaagatggct 118174

                                     
Query: 219    gggctgccccgcaggatcatcaa 241
              ||||||||||| || ||||||||
Sbjct: 118173 gggctgccccgtagaatcatcaa 118151
























[ summary ]

>|AV578948.1|141300168| AV578948 Abe mouse ES cell Mus musculus cDNA
           clone 19990601EK01B04, mRNA sequence
          Length = 398

 Score = 83.8 bits (42), Expect = 5e-14
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 192 ccgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||| | ||||||||||||||||||||||||
Sbjct: 1   ccgaactcgggatctgacaagataggcgggctgccccgcaggatcatcaa 50
























[ summary ]

>|CA451740.1|24816160| UI-M-FX0-ccj-h-23-0-UI.r1 NIH_BMAP_FX0 Mus
           musculus cDNA clone IMAGE:6820392 5', mRNA sequence
          Length = 732

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                            
Query: 193 cgaactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||| |||||||||| |||||||||
Sbjct: 2   cgaactcgggatctgacaagatggccggactgccccgcatgatcatcaa 50
























[ summary ]

>|BY099029.1|26209646| BY099029 RIKEN full-length enriched, adult
           male liver Mus musculus cDNA clone K630125K14 5', mRNA
           sequence
          Length = 374

 Score = 79.8 bits (40), Expect = 7e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 202 gatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gatctgacaagatggccgggctgccccgcaggatcatcaa 40
























[ summary ]

>|BY098096.1|26208713| BY098096 RIKEN full-length enriched, adult
           male liver Mus musculus cDNA clone K630119O15 5', mRNA
           sequence
          Length = 426

 Score = 79.8 bits (40), Expect = 7e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 202 gatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gatctgacaagatggccgggctgccccgcaggatcatcaa 40
























[ summary ]

>|BY077516.1|26178964| BY077516 RIKEN full-length enriched, adult
           male liver Mus musculus cDNA clone K630010A22 5', mRNA
           sequence
          Length = 383

 Score = 79.8 bits (40), Expect = 7e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 202 gatctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gatctgacaagatggccgggctgccccgcaggatcatcaa 40
























[ summary ]

>|BI151478.1|14611479| 602917488F1 NCI_CGAP_Lu29 Mus musculus cDNA
           clone IMAGE:5067908 5', mRNA sequence
          Length = 47

 Score = 79.8 bits (40), Expect = 7e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 173 ccggagacaagagcagaggccgaactcgggatctgacaag 212
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ccggagacaagagcagaggccgaactcgggatctgacaag 40
























[ summary ]

>|CF534771.1|34586739| UI-M-GH0-cgx-c-03-0-UI.r1 NIH_BMAP_GH0 Mus
           musculus cDNA clone IMAGE:30536402 5', mRNA sequence
          Length = 373

 Score = 77.8 bits (39), Expect = 3e-12
 Identities = 42/43 (97%)
 Strand = Plus / Plus

                                                      
Query: 199 cgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 1   cgggatctgacaagatggtcgggctgccccgcaggatcatcaa 43
























[ summary ]

>|AC146920.3|66773529|Otolemur garnettii clone CH256-154N14, complete
              sequence.
          Length = 163387

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                             
Query: 195    aactcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
              |||||||||||||||||||||||| ||||||||| ||||||||||||
Sbjct: 100685 aactcgggatctgacaagatggccaggctgccccccaggatcatcaa 100639



 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 0/35 (0%)
 Strand = Plus / Plus

                                              
Query: 207 gacaagatggccgggctgccccgcaggatcatcaa 241



 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 0/35 (0%)
 Strand = Plus / Plus

                                              
Query: 207 gacaagatggccgggctgccccgcaggatcatcaa 241
























[ summary ]

>|AA832626.1|2906354| vw43h11.r1 Soares_mammary_gland_NbMMG Mus
           musculus cDNA clone IMAGE:1246629 5' similar to
           SW:UBCC_HUMAN Q16781 UBIQUITIN-CONJUGATING ENZYME E2-17
           KD ;, mRNA sequence
          Length = 527

 Score = 75.8 bits (38), Expect = 1e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 196 actcgggatctgacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1   actcgggatctgacaagatggccgggctgccccgca-gatcatcaa 45
























[ summary ]

>|CN456076.1|46461802| UI-M-HN0-coh-a-20-0-UI.r1 NIH_BMAP_HN0 Mus
           musculus cDNA clone IMAGE:30644659 5', mRNA sequence
          Length = 341

 Score = 71.9 bits (36), Expect = 2e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 206 tgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||||||||||||
Sbjct: 1   tgacaagatggccgggctgccccgcaggatcatcaa 36
























[ summary ]

>|CA529497.1|25043563| 9011-47 Mouse E14.5 retina lambda ZAP II
           Library Mus musculus cDNA, mRNA sequence
          Length = 600

 Score = 69.9 bits (35), Expect = 7e-10
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 207 gacaagatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||||||
Sbjct: 1   gacaagatggccgggctgccccgcaggatcatcaa 35
























[ summary ]

>|BG519383.1|13514991| 602577646F1 NCI_CGAP_Mam6 Mus musculus cDNA
           clone IMAGE:3498011 5', mRNA sequence
          Length = 57

 Score = 67.9 bits (34), Expect = 3e-09
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                             
Query: 185 gcagaggccgaactcgggatctgacaagatggcc 218
           ||||||||||||||||||||||||||||||||||
Sbjct: 24  gcagaggccgaactcgggatctgacaagatggcc 57
























[ summary ]

>|CN705719.1|47474468| E0506A05-5 NIA Mouse eight-cell-Embryo cDNA
           library (Long) Mus musculus cDNA clone NIA:E0506A05
           IMAGE:30878692 5', mRNA sequence
          Length = 481

 Score = 65.9 bits (33), Expect = 1e-08
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 205 ctgacaagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||||||||||| |||||||||
Sbjct: 1   ctgacaagatggccgggctgccccgcacgatcatcaa 37
























[ summary ]

>|BI739032.1|15716058| 603359882F1 NIH_MGC_94 Mus musculus cDNA
           clone IMAGE:5366756 5', mRNA sequence
          Length = 32

 Score = 63.9 bits (32), Expect = 4e-08
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                           
Query: 187 agaggccgaactcgggatctgacaagatggcc 218
           ||||||||||||||||||||||||||||||||
Sbjct: 1   agaggccgaactcgggatctgacaagatggcc 32
























[ summary ]

>|DV074077.1|76401375| VP01_18_M22.x1 FH VP01 Mus musculus cDNA
           clone VP01_18_M22 similar to Ubiquitin-conjugating
           enzyme E2N, mRNA sequence
          Length = 948

 Score = 61.9 bits (31), Expect = 2e-07
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 211 agatggccgggctgccccgcaggatcatcaa 241
           |||||||||||||||||||||||||||||||
Sbjct: 35  agatggccgggctgccccgcaggatcatcaa 65
























[ summary ]

>|XM_989201.1|94409278| PREDICTED: Mus musculus similar to
           ubiquitin-conjugating enzyme E2N (LOC546362), mRNA
          Length = 845

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 210 aagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||| ||||||||||||
Sbjct: 6   aagatggccgggctgccccacaggatcatcaa 37
























[ summary ]

>|XM_621074.3|94408111| PREDICTED: Mus musculus similar to
           ubiquitin-conjugating enzyme E2N (LOC546362), mRNA
          Length = 845

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 210 aagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||| ||||||||||||
Sbjct: 6   aagatggccgggctgccccacaggatcatcaa 37
























[ summary ]

>|XM_910030.2|94408073| PREDICTED: Mus musculus similar to
           ubiquitin-conjugating enzyme E2N (LOC635086), mRNA
          Length = 846

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 210 aagatggccgggctgccccgcaggatcatcaa 241
           ||||||||||||||||||| ||||||||||||
Sbjct: 6   aagatggccgggctgccccacaggatcatcaa 37