W027B03 - 02018

   1 -   10:   6  6  6  6  6  4  4  8  8  8     AGGAGGCTCT
  11 -   20:   4  6  6  6  8  8  8  7  6  4     AGTCTTCTTG
  21 -   30:   4  6 10  6  6  6  6  6 10 12     CGTTGCAGGG
  31 -   40:  13 12  7  7 11 10 11  7  7 10     ACTGGGACCT
  41 -   50:   8  8  8 17  9 12 15 12 11 11     GACAATGCTG
  51 -   60:  12 11 13  9  9 10  7  6 12  6     CTCTGGCAAG
  61 -   70:   6  8  8  8  8 10  9 10 13 14     CGTCAGGCTG
  71 -   80:  14 15 14 21 17 22 24 24 24 24     CTGAAGGGCA
  81 -   90:  24 24 27 30 27 28 24 20 18 14     AAGAGGAAGG
  91 -  100:  12 12 15 11 10 18 13 17 17 20     ACTCTAAGTC
 101 -  110:  17 16 10 10 10 21 25 16 12 12     AAGGAGTTCA
 111 -  120:  10 16 14 16 20 18 22 21 18  4     CGAACAGCGG
 121 -  130:   4  4 16 23 25 29 33 39 39 36     NGTGTCGCGG
 131 -  140:  38 36 36 38 38 38 34 34 34 34     GGCTCTAGCC
 141 -  150:  34 37 36 36 37 37 37 37 37 37     GCTCGCTCGC
 151 -  160:  37 37 37 38 37 34 34 37 37 37     TCGCTCGCGC
 161 -  170:  37 37 38 37 33 32 30 28 28 28     GCGCGCTGCG
 171 -  180:  31 28 28 28 31 31 34 37 38 37     GAGCGATTCC
 181 -  190:  37 37 34 34 34 37 37 34 37 37     CGGTTCCGGG
 191 -  200:  37 27 24 24 32 32 34 34 34 37     TAGGGGAAGC
 201 -  210:  37 37 38 40 40 40 40 37 29 27     AGCCCCTTTC
 211 -  220:  27 32 32 34 34 34 29 29 32 32     CGAAGCCGAG
 221 -  230:  34 34 25 32 15 12 12 25 29 36     GCTTTGCGCC
 231 -  240:  36 36 33 36 31 27 20 17 14 13     CTAAAACAAG
 241 -  250:  10 16 18 26 32 34 31 28 25 17     TAGCCCCAAC
 251 -  260:  18 17 17 17 21 18 27 20 30 14     GTGGGAGAAA
 261 -  270:  13 10 10 10 10 12 18 12 18 15     CAAAAGGTAT
 271 -  280:  29  9  9  9  9 12 15 10 10 13     TTGCCCCCCT
 281 -  290:  12 18 14 17 15 16 14 10 10 10     GGGCGTTGAA
 291 -  300:   8  8  8  8 17 17 21 16 10  9     AAGAAACGCT
 301 -  303:   9  9  7                          TGT

RACE product (3' -> 5' orientation)
>W027B03 - 02018
AGGAGGCTCTAGTCTTCTTGCGTTGCAGGGACTGGGACCTGACAATGCTG
CTCTGGCAAGCGTCAGGCTGCTGAAGGGCAAAGAGGAAGGACTCTAAGTC
AAGGAGTTCACGAACAGCGGNGTGTCGCGGGGCTCTAGCCGCTCGCTCGC
TCGCTCGCGCGCGCGCTGCGGAGCGATTCCCGGTTCCGGGTAGGGGAAGC
AGCCCCTTTCCGAAGCCGAGGCTTTGCGCCCTAAAACAAGTAGCCCCAAC
GTGGGAGAAACAAAAGGTATTTGCCCCCCTGGGCGTTGAAAAGAAACGCT
TGT

trapped sequence (5' -> 3' orientation) >W027B03 - 02018 TCTTTTCAACGCCCAGGGGGGCAAATACCTTTTGTTTCTCCCACGTTGGGGCTACTTGTT TTAGGGCGCAAAGCCTCGGCTTCGGAAAGGGGCTGCTTCCCCTACCCGGAACCGGGAATC GCTCCGCAGCGCGCGCGCGAGCGAGCGAGCGAGCGGCTAGAGCCCCGCGACACNCCGCTG TTCGTGAACTCCTTGACTTAGAGTCCTTCCTCTTTGCCCTTCAGCAGCCTGACGCTTGCC AGAGCAGCATTGTCAG masked sequence (5' -> 3' orientation) >W027B03 - 02018 ACAAGCGTTTCTTTTCAACGCCCAGGGGGGCAAATACCTTTTGTTTCTCCCACGTTGGGG CTACTTGTTTTAGGGCGCAAAGCCTCGGCTTCGGAAAGGGGCTGCTTCCCCTACCCGGAA CCGGGAATCGCTCCGCAGCGCGCGCGCGAGCGAGCGAGCGAGCGGCTAGAGCCCCGCGAC ANNNCGCTGTTCGTGAACTCCTTGACTTAGAGTCCTTCCTCTTTGCCCTTCAGCAGCCTG ACNNTNGCCAGAGCAGCATTGTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNN