W174F05 - 10459



1 - 10: 6 6 6 6 6 6 6 8 7 7 TTTGGAAAAT 11 - 20: 7 7 7 7 4 4 4 4 4 6 GTAACTAGAG 21 - 30: 4 4 7 13 16 13 4 0 4 4 GTACGGGNAA 31 - 40: 4 4 9 9 6 6 6 6 11 4 TCCGCCCTGT 41 - 50: 0 4 13 14 15 4 0 4 6 8 NCACAGNATC 51 - 60: 10 4 0 4 13 13 4 0 4 17 ATNCAAGNCT 61 - 70: 17 10 8 8 9 19 19 15 9 10 TATACGATAC 71 - 80: 9 9 4 0 0 4 13 16 20 22 CCGNNTCGAT 81 - 90: 22 27 32 32 19 16 4 4 4 15 CCCCACTCGG 91 - 100: 19 19 22 25 25 25 27 34 39 26 AAAGACCGCG 101 - 110: 21 19 16 9 9 17 25 32 32 32 AAGAGTTTGT 111 - 120: 32 29 29 29 29 29 34 40 37 34 CCTCAACCGC 121 - 130: 34 34 32 29 22 19 21 22 26 26 GAGCTTGATG 131 - 140: 29 35 35 35 35 35 33 33 33 33 ATCCTGCGGG 141 - 150: 35 35 30 30 30 37 42 42 26 26 GCAGCCCGGC 151 - 160: 26 26 20 29 30 30 16 16 17 19 CATCTTGTCA 161 - 170: 20 26 35 37 37 35 35 35 31 29 GATCCCGAGT 171 - 180: 28 30 30 35 33 31 28 28 30 30 TCGGCCTCTG 181 - 190: 30 35 36 33 35 37 42 42 42 42 CTCTTGTCTC 191 - 200: 44 42 42 43 38 33 28 28 28 30 CGGCTCCGCT 201 - 210: 33 22 22 22 25 24 25 25 24 21 CTCCTCACGC 211 - 220: 19 13 12 12 12 19 8 8 6 6 TCGAGTGGCA 221 - 230: 8 11 10 15 17 19 19 9 9 9 GACCCCCCCC 231 - 240: 9 4 0 4 8 8 9 6 6 9 GGNCGGGTGT 241 - 250: 9 11 12 8 8 9 9 16 9 12 GCGAGTATCC 251 - 260: 12 9 7 9 9 9 9 9 9 20 CCAATATGTT 261 - 270: 13 13 13 17 26 19 15 13 9 9 GTTGACAGGA 271 - 280: 9 12 11 11 7 8 9 15 4 4 TATCGGGGGT 281 - 290: 4 7 7 7 4 0 4 0 4 4 GGCGGNTNTA 291 - 300: 0 4 15 20 21 20 9 9 10 17 NTTTTGCCTG 301 - 310: 14 9 9 10 10 4 0 4 4 0 AACAGTNTTN 311 - 320: 4 6 6 4 0 4 19 19 33 33 CCTGNTGCCG 321 - 330: 29 23 13 10 9 4 0 4 12 12 CCTGTTNAGT 331 - 340: 9 10 12 14 13 13 9 4 4 13 ACGATCCTTA 341 - 350: 11 11 9 11 9 12 20 9 10 9 GGTCAAATTT 351 - 360: 9 9 9 9 9 9 8 8 9 10 AAGAGATAAT 361 - 365: 11 9 8 10 8 GAAAA
RACE product (3' -> 5' orientation) >W174F05 - 10459 TTTGGAAAATGTAACTAGAGGTACGGGNAATCCGCCCTGTNCACAGNATC ATNCAAGNCTTATACGATACCCGNNTCGATCCCCACTCGGAAAGACCGCG AAGAGTTTGTCCTCAACCGCGAGCTTGATGATCCTGCGGGGCAGCCCGGC CATCTTGTCAGATCCCGAGTTCGGCCTCTGCTCTTGTCTCCGGCTCCGCT CTCCTCACGCTCGAGTGGCAGACCCCCCCCGGNCGGGTGTGCGAGTATCC CCAATATGTTGTTGACAGGATATCGGGGGTGGCGGNTNTANTTTTGCCTG AACAGTNTTNCCTGNTGCCGCCTGTTNAGTACGATCCTTAGGTCAAATTT AAGAGATAATGAAAA
trapped sequence (5' -> 3' orientation) >W174F05 - 10459 AGGATCGTACTNAACAGGCGGCANCAGGNAANACTGTTCAGGCAAAANTANANCCGCCAC CCCCGATATCCTGTCAACAACATATTGGGGATACTCGCACACCCGNCCGGGGGGGGTCTG CCACTCGAGCGTGAGGAGAGCGGAGCCGGAGACAAGAGCAGAGGCCGAACTCGGGATCTG ACAAGATGGCCGGGCTGCCCCGCAGGATCATCAAG masked sequence (5' -> 3' orientation) >W174F05 - 10459 TTTTCATTATCTCTTAAATTTGACCTNNGGATCGTACNNNACAGGCGGCNNNNNNNNNNN CTGTTCAGGCAAANNNNNNNNCGCNNNCCCCGATATCCTGTCAACAACATATTGGGGATA CTCGCANNCCCNNNCGGGGGGGGTCNNCCACTCGAGCGTGAGGAGAGCGGAGCCGGAGAC AAGAGCAGAGGCCGAACTCGGGATCTGACAAGATGGCCGGGCTGCCCCGCAGGATCATCA AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNN